Rattus_norvegicus Locus Mono:14:SNORA76
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Mono:14:SNORA76
Rattus_norvegicus
Mono:14:SNORA76
X
SNORA76
1001..1127
2127
TGCTGGCTGCCAGTCAAGCTGTGCTCACTGGTGAACTAGTGGCCATGAATGTTTTGAGT
GTAACCAACTACCCACTGATTGGATTTGAGGCCTTCTCCACAGCAGGAAATTTATGCCCG
GCCCTGTAAACTTGGTCATAGCTTGGGAGATCATAGGCCCTAGGTGAACCTACTACCTTT
GTTTCACTAAACGGACTTGTCAAGTTGCTTTCTAAATCTTTGTTTATCCTAAGTGACTGT
GACATGCTTGGGCTTAGATGGGGCATTTACATCAACCTCCCCTTCCCCAAAGGCTCTGGA
GACATTGTAGAAGAGGCGGAAAGAGAGGAAGAGCAGCAGTATAGGTGAAATGTGGCATCT
GGACTAAAGATGACTATTGTACTTAGGAACGCACTGTAAAATCAAGCCATCAAAAGCAGT
TAATGCTCTAGCAGACATCACGAGCTATGACAGTGGGAGGAGGAGTGTTGGAGGTGTATG
GGAAGTTAAGGGGGGAGGGGTGGAGTAGAGATGAGCATGTTGCTTTGGATACGAGTATAC
CTAAAACTATTTTAAAATAAATAGCTAATAAAAAAAAAGATGACCTGAAGAAATACTGGT
ACTCAAAGAACGAGCCACTAGCCTCACGTTATAGATATGAGAAACTGGGGCGAAGGAGTT
AAACCATTCCCCCAAGTGAAGAGCTGGATTAGCACCCTGATTCTTTATAAAGCTGCCCCC
ATGTTGGGGCAGGTGATATTGATCTTGGGAATCTTCCCAAGAAAGCTTAAAAAAAAAAAA
GAGGGTTCTGGAGGACTACGTTGAGAATGTTTATAGCCTACCCTTGCCAACTGCCAGCTA
GTCTGCTTAGCTCTGTAACATTAGCATTTGTGGGTGCACTTTAGAGAGGAAGAGACCAGC
CTGGTCTACATACTAAGTTCCAAGCCAGCCAGGGCTACATAGTGAGACCTTCGTTGTTTT
TTTTTTTTTTTTAAGAAAAAAAAAAGAAAGAAAGAAAAAGCCCGCCGCCTTTGCGTCCCC
AGCTCACCGTGGTGCCGGGATTAAGCTGAGGCGCCATAGCACTTTACTGGCGCATAACTG
GGGCCGCCTGCCCTTTGCGGGCGGCCCTTTTAACTGCTAGCTACAGGCTAAGAAATAAAA
AGCACCACCACTACCACCACTACCACCACCACCACCACTACCACCACCACCAGGCTACCC
AAGACCCATAGTTCCTTCAACACTCCCCAGTAAAGCCACATTGCTGGGATGCCACAGTTC
AGATGAGGGCCTCTCTTCCCTTTCTTGCTTCCACAGCTCAGTCTTTGCTACTCCCATTCC
AGGAAGCCTGTCTGTCAGTGCTGCAAATCAGAGAGGATACTTCCCAGAACTCACTTGCCC
TCTGAGTTCCAGTGGCTTTTTTCCCCTTTCATGGGGGACAGGATGAATGGGAACACTATT
ATATTCTCTATTATAAAGACATATTTGTACTCCATATTGTAGAAAAGAATCAGCCCGTAC
ATGTTATTCCTTAGCTTAGCAGTAACCACTGTTAATGGTTTGTTTGTTCTGTGCTATCTC
CTCTCACAGCTCAGCAAGGCTGATGATACCAGCAGAAACTGAAGTTTCAAGAGCCCGAGG
GAAGAGTACAACGGCTGATAACAGAAAAGGCACAGACATCACAAGTTTCGGCTACGTGAC
TGACCACCTATCCAGAGGGACAAAACAGAGCTGGAGAATGATTGATTGTCTGCTCCTGCT
CCCCACCCCCTTCCTCCCCGTATAAGATAGGTGATAAGATAGAAGACAGATTTTCCGGAG
GTTAAGTCACTGTCTCCTCAGATTGCCAAATCTCTGAATAAAACTCAGTTTGAAAATTCA
AAGTTAGCTGAAGCTGGGAAAATGCATGCCTTTAATCTCAGGACTTGGGCGCCAAAGGCA
GGAGGATCTCTGTGAGTTTGACTCTAGCCGGGTTTACAGAGCTAGTTCCAGGATAGCCTT
CATGAAGGACATTACCAGAAAGGGTTGACTGAGGTAGGAAGACACATCCTCAATGTAACA
GGAGCTGTTAGACCGGCTCACTCAGTACCAGCATTGCCCTGCTCTGTGTAGTGAACAAGA
ACCCTCACGCTCTAGCCTCCATAGTTGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved