Rattus_norvegicus Locus mono: SCARNA9
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus mono: SCARNA9
Rattus_norvegicus
mono: SCARNA9
1
SCARNA9
980..1292
2292
CAGAGTAGACTTTATAGTCAAGAGATAAATATTTGAGTCCTGTATCTGCTCCTTCAATG
CTCTATGATACAATCAGCAAAATATTGATTACATAATGACACAGTCTAGCAAATGGCTGA
TATTTAAACAGTAGAAGCAACGTATTTATAAATGCATTTATGTATATGGTACCTCTGGGA
ATTAATGTCACCCTGCTGTGGAGATAAGGTGATGGGTATATATACTAAAGAAGTCACAGA
AGGACTGTATAACGCAAAATCAAATACAAAAATGTAGGTTTAATCTTCCAGTACTCTTGC
TTCCATAAGTGCAAAGGATTAAAAACTGAGTAGAGATTTAGTATATGTTCACAAATCTGT
GTACTGAAGGTGTACACAGGTACTGCCCTTATAATAAATACAAAGATAGTAATAACAAAA
CTATACTTTCTATAAATATTTTTGTGTTTCTCAAATTCATTTTTACCTGGATCTTTCGAG
CGCTGTATCTTTTAGCAGTTTCTTCCTCTAGACGCATGCTGTATAACCTTGCACGTAACT
TTTTCATAGCCAGCTCCCTGTTCTTCAGCTGAGATCTTTCTTGCTGGCATTCAGAAATAA
TACCTGAATAATGTTATGAAAATTAAGAGTTTAAATACAAAAATCTTCTTTATTATCAAG
GACTATTCCTTTTCTTTCTCATTCTTTTTCTTCTTTGACGAAGCAATAAAAAATGAGAAT
CGAAGAGAAGACTTTAATTTTCTGTTTGTTTGTTTTCTGAGACAGGGTTTTATTGTGTAA
CAGCCCTGGCTGTCCTGGAACTTGCTTTGTAGAGCAGGCTGGCCTTGGACTCAGAGATCC
ACCTGCCTCTGCCTCCGAGGTGCTGGGATTAAATGTAAGCACTACCACGCATGGTACACT
TTAAATATTTTTAATACAGACTTTTTCATAGCCTCAGCTATCATAATTTTTAAAAAAGAT
TTATAGAAATGAATGTATATTCTCTGAGATCTACTGAAGTGGATCAATGATGAAAATAGC
CAAATCTGAGCATCAGAAGGCCTTTTGGTCGGCTGGGTGCATGATCTCTATAGTTCTGAG
AAGCAAAACTACAAAACAGCTTAAACAATTAGGGTCTGTCTATGGTGAGAGAAGGAAAGG
GTGGTATGTGGGTGTATGGGCGTGCGTGTATGCATGCATCTGTGTGTGTGTGTGTGTGTG
TGTGCGTGCGCGTGGTCATTTCTGAGCAATGATGAAAAGGTTTTAGTACTGAATTTTGTC
ACTATGAAGGTTTCTACACTTGATCTGAGCTCAGAATAAAAAAAAAGAAATGAATGTATA
TAGAATATAGAATATAGTTGAGGATTTCCTTTTTTAACATATTTTTATTTATACAGCTCA
CTTATCACCATATTTAACAGTTTTCTGTATGTAAAGGACAAAGTCCTACCTGTCCACCTG
TCTTCATTACTCCTGGTTAACAGGAGCTATGGCACTTTAAGATCCATATATGTGGTAGTC
CAGGAGACCTGACCTGTATTAACTAGACGCTCCTTGTCACTCATAAGCCACTCCGGTGCT
CTATCTAGTAAGATTTAAAAACACATGTCACTTTGCCCAATTATCTAGATTCCAATTCTG
TTGGAAAGAGGCTCCTGAAATTGTATCTAAAAGTGTCCATGTATCATGCTTCTCTGTAGA
AAGTCCAATGATCTGGGTCTTAGCACTGCAGTTAATAACTGATAATTTAGAACATTTTCT
GATAAATAATCATATAATTCACTGAGGCTTTTTTGGAAATAGCAAATCTAGTAAGAATAT
ATCCCATAACTCAATTGGCAGGACTCAACTGTTCTCTTCATAGTGACTAACCCCTCCTCC
TTCCTGGAATTATCCTGAACAGATCAGCCACAGAACAAAGTGGCTAGCTCAGAGCCCTTA
ATGCTGTATTTCGGTATCTGGAAGTTTGTTCCAGTGGAGAGCAGTCAGTCCCCCAGAAAT
TGATCTTGACTCAGAGTTTCATGTTGAAAACTGAAGGACACACCTGTGGGAAGATGAACT
ATCCGAACAGCACTGTCTGTGGTATTTACGTGCTGACCTCCAGCTCCACTTGCTCTCTTC
GTATCAATTCTCAAATCTTTAGGGTTAATCACCAGTTTAATCTATACATACAAAAAAAGT
TGGAACTTTAAGGAACAATTACCCACACCAATTGTCTCAGGTAAGACCCACACAGTATAA
ATACATGCCACACAGAAAATGTAAAAGGTCCAAGAACAGACCAGAAGCAGAATGTTACTT
TAGATGGTTCGAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved