Rattus_norvegicus Locus Poly:14:SNORD115
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Poly:14:SNORD115
Rattus_norvegicus
Poly:14:SNORD115
1
SNORD115, SNORD115, SNORD115, SNORD115
1001..1078, 2837..2914, 4676..4753, 6514..6591
7591
TTTCACTTACCTCTCCGGCCACAGGGAACCTAGCCAGTAGGGTAGATTGATGTTGAAGG
TTTTGCTTTGGCTATCAATTCCCTTCCATGTATACTCACACTGCTTCATCCTTGATCTTA
CTAAAGTTTACTTCAGTATTCATCAGAAAACAAATGCTATCAAGGAGATGGTTTTTGGAG
CTGTTGGGACCGAAGAACGTGCTGTCAATGGGATACTTGCAAACACAAACTGATCTAGTC
CCACGAATTTTGGTCACATTTTCAGTTTGATTGCATGGCAATCACTGAGTGCTAACACTC
AGGGATTCATGGCCAAAGTACTTGTCGCTTTCTTCTGGGCAACGGATTCTCTTCAGCATT
CACTTACCAGCTGTGGGAACTGATTTGTTACCATGCAGTATGGAAATGGGGAGGAATGAT
CATAGCCTAGCACATAAAATTTGAAACGCACAAGTCTCTTGAAAATTTGAGTAAAGTATA
TGTAACTGTTCGTGTATTGTCCTTCCAATATTACTCAGGGAACTTCACCTTTGCCTTGGT
TTCTGACAATGTTTAGCAATTGAAAGATTTGATCGGTGATTCTGATCAAGAGCATGTGTG
ATCCCCTTCCTCAATGATTTGGTTTTGGGTACCTATTGACCTATTGATCTCTTGGGGAAG
TAACTTTCCAGGGTGTTGGGAATGTCAGCATGGAAGTGGGAATGAAGAAGTGATTCTACT
CAGTGGCATCATACATTAGACTTCTTAAACAGTCTCCTTAAAATTAACATGATTGTATGA
ACTGAAGGGGTACAATTGCCCTCACATCTTGCTTCTTCCTTTTTAGAGAGGACAGTCTTC
AAATTCATGCTAGATCTCCCCTTATTCCACACAAGAGAGCTGTGCCTCCTATCCTCTGCA
CTTGCAAGTGAGGATTAAAATTCTGAGGCAGTGTTGGCAGACCAGGTAAGCCATGGTGCA
GGTGAAATTACATTATTGGCAGTTGTGTACTGCCTCTGTCTGTGTCAATGATGACAACAG
AAAGTCAAGAACAGAATGATGACATAAAAATCATGCTCAATAGGATTACGCTGAGGCCCA
ACCAGGGAGCCAGGGTTACAAGCACTACTTTGTCTCTTTGAGGACCACTTGCGGGACTCA
TCTGAGCTGCTCTGATGCCCTTGTGCTCTTTCCCCTCTGTGGGAACCTGGACAATCTTAG
TGCAAGTGTGCTGGCAAACACTGCCTGCCAACTAGCACCTAGTCTCATAATCTGCTTGTG
TGCAAGTCTGCAACACCAACCCCGTCATCATTACCCTCTCTGCTCTGATGTCTTGCAGTC
ACCTGGCATCACCCCTGCGGTCCAGTGGATCACTATTCCCAGGTGAGTGAAATGATCACG
ATTAATGGATTGAACTTCTTATGAGATATTCCTCAGTATGTTGACCAATAATTTCAGCCC
ATCAAAGGTTTCTGAATTAAAAATAATGCAATACAAGTCAGAAATGAATTTCACTTCTCA
GTATGTTCTGTCCCTTTGAACGGCACTATTAAAAATGTAGAGAAATTCCTTTCTACCTGT
AGTTCATAGAGCCATAAAATTGAATTTCTTGGAAGAGACTCTAGATGATACTATCTACAC
AAAAGGAGGGATCTGGAATATGAACATACCTTTTGAATTTCGAGAAATTTCAGTCCACAC
ACAGGCTCACAAATCCAAGCTGGTGCACAGAGATCTTTTTCCAATGGCAAGGGGAACCCA
GGAATAAGATTTTACTTTAGAGTTGTAGAAATTGGCGATAAATTTTCTGCATCAAAAGAC
ACTCCAAGAATTATTTCCACAAAGAGAGCTGGCAAAACTTTTCACATAATTCTCAGGCCA
CAGGGAACCTAGCCAGTACGGGAGATTGAATTTGAAGGTGTGGCTTAGACTACCAATTCC
CTTCCATGTATACTCACACTGCTTCATGCTTGATCTTACTAAAGTTTACTTCCGTATTCA
TCAGAAAACAAATGCTATCAAGGAGATGGTTTCTGGAACTGTTGGTACATAAGAACGTGA
TGTCAATGGGATACTTGCAAACACCAACTGATCTAGTCACACGAATTTTGGTCACATTCT
CAGTTTCATAACATGGCAATCACTGAGTGCTAACGCTCAGGGATTCATGGCCAAAATACT
TGTCGCTTTCTTCTGGGCAACAGATTCTCTTCAGCATTCACTTACCAGCTGTGGGAACTG
ATTGTTACCATGCAGTATGGAAATGGGGAGAAATGAACATAGCCTAGCACATAAAATTTG
AAACGCACAAGTCTCATGAAAATTTGATTAAAGTATATGTAACTGTTCGTGTATTGTCCT
TCCAATATTACTCAGGGAACTTCACCTTTGCCTTGGTTTCTGACAATATTTAGCAATTGA
AAGATATGATCGGTGTATCTGATCAAGAGCATGTGTGATCCCCTTCCTCAATGATTTGGT
TTTGGGTACCTATTGACCTATTGATCTCTTGGGGAAGTAACTTTCCAGGGTGTTGGGAAT
GTCAGCATGGAAGTGGGACTGAAGAAGTGATTCTACTCAGTGGCATCATACATTAGACTT
CTTAAACAGTCTCCTTAAAATTAACATGATTGTATGAACTGAAGGGATACAATTGCCCTC
TCTTCTTGCTCTTTCTTTTTAGGGAGGACAGTCTTAAAATTCAAGCTAGGTCTCCTCAGA
TTCCACACAAGAGAGCTGTCCCTCGTATCCTCTGCACTTGCAAGTGAGGATTAAAATTCT
GAGGCAGTGTTGGCAGACCAGGTAAGCCATGGTGCAGGTGAAATTACATTATTGGCAGTT
GTGTACGACCTCTGTCTGTGTCAATGATGACAACAGAAAGTCAAGAACAGAATGATGACA
TAAAAATCATGCTCAATAGGATTACGCTGAGGCCCAACCAGGGAGCCAGGATTACAAGCA
CTACTTTGTCTCTTTGAGGACAACTTGCAGGACTAATCTGAGCTGCTCTGATGCCCTTGT
GCTCTTTCCCCTCTGTGGGAACCTGGACAATCTTATTGCAAGTGTGCTGGCAAACACTGC
CTGCCAACTAGCACCTAATCTCATAATCTGCTTGTGTGCAAGTCTGCAACACCAACTGGG
TCATCATTACCCTCTCTGCTCTGATGTCTTGCAGTCACCTGGCATCACCCCTGCGGTCCA
GTGGATCACTATTCCCAGGTGAGTGAAATGATCATGATTAATGGATTGAACTTCTTATGA
GATATTCCTCAGTATTTTGACCAATAATTTCAGCCCATCAAAGGTTTCTGAATTAAAAAT
AATGCAGTACAAGTCAGAAATGAATTTCACTTCTCAGTATGTTCTGTCCCTTTGAATGGC
ACTATTAAAAATGTAGAGAAATTCCTTTCTACCTGTAGTTCATACAGCCATAAAATTGAA
TTTCTTGGAGTAGATCCTAGATGATACTATCTAAACAAAAGGAATGATCTGGAATATGAA
CATACCTTTTGAATTTCGAGAAATTTCAGTCCACACACAGGCTCACAAATCAAAGCTGGT
GCACAGAGATCCTTTTCCAATGGCAAGGGGAACCTAGGAATAAGACTTTAGTTTAGAGAT
GAAGAAATTGGCGATAAATTTTCTGCATCAAAAGACACTCCAAGAATTATTGCCCCAAAA
AGAGCTTCGCGAAATTTTTCAAGTAACTCTCAGGCCACAGGGAACCTAGCCAGTAGGGTA
GATTGAAGTGGAAGGTGTGGCTTTGGCTACCAATTCCCTTCTATGTGTCATCACACTCCT
TCATTCTTGATCTTACTAAAGTTTACTTCAGTATTTATCAGAAAACAAATGCTATCAAGG
AGATGGTTTCTGGAGCTCTTGGGACAGAGGAACGTGATGTCAATGGGATACTTGCAAACA
CCAACTGATCTAGTCACACGAATTTTGGTCACATTCTCAGTTTGATCACGTGGCAATCAC
TGAGTGCTAACGCTCAGGGATTCATGGCCAAAATACTTGTTGCTTTCTTCTGGGCAACGG
ATTCTCTTCAGCATTCACTTACCAGCTGTGGGAAGTGATTGTTACCATGCAGTATGGAAA
TGGGGAGGAATGAACATAGCCTAGCACATAAAATTTGAAATGCACAAGTCTCATGAAAAT
TTGATTACAGTATATGTAACTGTTTGTGTATTGTCCTTCCAATATTACTCAGGGAACTTC
ACCTTTGCCTTGGTTTCTGACAATGTTTAGCAATTGAAAGACTTGATTGGTGTATATGAT
CAAGAGCATGAGTCATCCCCTTCATCAATGATTTGGTTTTGGGTACCTATTGACCTATTG
ATCTCTTAGGGAAGTAACTTTCCAGGGTGTTGGGAATGTCAGCATTGAAGTGGGACTTAA
GAAGTGATTCTACTCAGTGGCATCATACATTAGACTTCTTAAACAGTCTCCTTAAAATTA
ACATGATTGTATGAACTGAAGGGATACAATTGCCCTCACATCTTCCTCTTTCTTTTTTAG
GGAGGACAGTCTTAAAATTCAAGCTAGGTCTCCCCTTATTCCACACAAGAGAGCTGTGCC
CTTGTATCCTCTGCACTTGCAAGTGAAAATTCAAATTCTGAGGCAGTGTTGGCAGCCCAG
GTAAACCATGGTGCAGGTGAAATTACATTATTGACAGTTATGTCCTGCCTGTGTCTGAGT
CAATGATGACAACAGAAAGTCAAAAACAGAATGATGACATAAAAATCATGCTCAATAGGA
TTACGCTGAGGCCCAACCAGGGAGCCAGGTATACAAGCACTACTTTGTCTCTTTGAGGAC
CACTTGCGGGACTCATCTGAGCTGCTCTGATGCCCTTGTGCTCTTTCCCCTCTGTGGAAA
CCTGGACAATCTTAGTGCAAGTGTGCTGGCAAACACTGCCTGCCAACTAGCACCTAGTCT
CATAATCTGCTTGTGTGCAAGTCTGCAACACCAACCCCGTCATCATTACCCTCTCTGCTC
TGATGTCTTGCAGTCACCTGGCATCACCCCAGTGGTCCAGTGGATCAGTATTCCCAGGTG
AGTGAAATGATCACGATTAATGGATTGAACGTCTTATAAGATATTCCTCAGTATTTTTAC
CAATAATTTCAGCCCCTCAAAGGTTTCTTAATTTAAAATAATGCAATACCAGTCAGAAAA
GAATTTCCCTTCTCAGTATGTTCTGTCCCTTTGAACTGTACCATTAAAAATGTAGAGAAA
TTCCTTTCTACCTGTTGTTAATACAGCCTTAAAATTGAATTTATTGGAAGAGATCCTAGA
TGATACTATCTACACAAAAGGAGGGACCTGGACTATGAACATACCTTTTGAATTTCGAGA
AATTTCACTCCACAAACAGGCTCACAAATCCAAGCTGTTGCACAGAGATCATTTTCCAAT
GGCAAGGGGAACCCTGGAATAAGACTTTACTTTAGACTTGTAGAAATTGGAGATAAATTT
TCTGCATCAAAAGACACTCCAAGAATTATTCCCTGAAAGAGAGCTTGGCAAAATTTTTCA
CGTAACTCTCAGGCCACAGGGAACCTAGCCAGTATGGGAGATTGAAGTTGAAGGTGTGGC
TTTGACTACCAATTCCCTTCCATGTATACTCACACTGCTTCATCCTTGATCTTACTAAAG
TTTACTTCAGTATTCATCAGAAAACAAATGCTATCAAGGAGATGGTTTTTGGAGCTGTTG
GGACAGAAGAACGTGATATCAATGGGATACTTGCAAACACCAACTGATATAGTCACACGA
ATTTTGGTCACATTCTCAATTTGATCACGTGGCAATCACTGAGTGCTAACGCTCAGGGAT
TCATGGCCAAAATACTTGTCGCTTTCTTCTGGGCAACTGATTCTCTTCAGCATTCACTTA
CCAGCTGTGGGAACTGATTGTTACCGTGCAGTATGGAAATTGGGAGGAATGAACATAGCC
TAGCACATAAAGTTTGAAACGCACAAGTCTCCTGAAAATTTGATTAAAGTACATGTAACT
GTTCGTGTATTGTCCTTCCAATATTACTCAGGGAACTTCACATTTGCCTTGGTTTCTGAC
AATGTTTAGCAATTGAAAGATTTGATCGGTGTATATGACCAAGAGCATGTGTCATCCCCT
TCATCAATGATTTGGTTTTGGGTACCTATTGACCTATTGATTTCTTAGGGAAGTAACTTT
CAAGGGTGTTGGACATGTCAGCATGGAAGTGGGACTGAAGAAGTGATTCTACTCAGTGGC
ATCATACATTAGACTTCTTAAACAGTCTCCTTAAAATTAACATGATTGTATGAACTGAAG
GGATACAATTGCCCTCACATCTTGCTCTTTCCTTTTTAGAGAGGACAGTCTTCAAATTCA
AGCTAGGTCTCCTCTTATTTCACACAAAAGTGTGTGCCCTCGTATCCTCTGCACTTGCAA
GTGAGGATTAAAATTCTGAGGCAGTGTTGGCAGCCCAGGTAAGCCATGTTGCAAGTGAAA
TTACATTATTGACAGTTGTGTCCTGCCTGTGTCTGGGTCAATGATGACAACAGAAAGTCA
AGAACAGAATGATGACATAAAAATCATGCTCAATAGGATTACGCTGAGGCCCAACCAGGG
AGACAGGGTTACAAGCACTACTTTGTCTCTTCTAGGACCACTTGCGGGATTCATCTGAGC
TCCTCTGATGCCCTTGTGTTTTTTCCCCTCTGTGTTAACCTGGACAATCTTAGTGTAAGT
GTGCTGGCAAACACTGCCTGCCAACTAGCACCTAGTCTCATAATGTGCTTGTGTGCAAGT
CTGCAACACCAACCCCGTCATCATTACCCTCTCTGTTCTGATGTCTTGCAGTCACCTGGC
ATCATCCCTGCTTTCCAGTGGATCATTATTCCCAGGTGAGTGAAATGATCACGATTAATG
GATTGAACTTCTTATAAGATATTCCTTGCTCTACTCCCAAACCCCGTGAGAGAGAGACCT
CACCACCTAGTCAGGTGGGCACTCTTGAGGCTGCAGAGCGGAGGAGACCACCAACACTGC
CCACCCCTGCCCACATCCCTGGCCCAAGAGGCAACTGTATAAGGCCTCTGGGTTCCCGAA
GGGGAGGGCCCAGGAGCGGCAGGACCTCTGTGCCTGAGACACCGTCGGAACCTGAAGGAA
ACAGACTGGATAAACAGTTCTCTGCACCCAAATCTCGTGGGAGGGAGAGCTAAACCTTCA
GAGAGGCGGGCGTGCCTGGGAGGCCAGAAGAGACTGCACTCTGCACATGTCCAGAAGCCA
GAGGAAAACACCAAATGCCATCTGGAACCCTGGTGCACGGAGGCTCCCGGAAAGAGCAGT
TCAGATCTTCCCAGTTGCTGCCGCTGCAGAGAGGAATTAGACAGTACCCCACGAGCAAAC
TTGAGCCTTGGAACCACAGGTAGGACCAACTTTTCCCCTGCAGGAAACCTGCCTGGTGAA
CTCAGGACACACAGAGGCAAAATTCCTCTAGGACCGGGCACTTCCTGTTTGTAACGGAAG
TCCCACACCCGCGGATCCCAGCCCGCAGCAGCTCTCTGCTCCCAAACCCCGTGGGAGAGA
GACCTCACCACCTGGTCAGGTGGGCACTCCTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved