Rattus_norvegicus Locus Mono:349:SNORA18
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Mono:349:SNORA18
Rattus_norvegicus
Mono:349:SNORA18
2
SNORA18
1001..1131
2131
GTTCTAAAGATACCTGTACCAATAATTCCTAAAAAAGAGGTCATGAATTTAAAGAAAGT
AAGTAGATGGTACATGGGAGAGGTTGGAAGGGGGAAAGAGAAAAGGGAAATGGTGTGTTA
TTGTTTCTTTTTTTAATTATTATTTTAAAAGTTCAAAGATCAATGAAATTAAAAGTAGGA
AACAATTATTGAAAACCCAACAAAACCAAAATCTAGCTCTCTGAGCCAATGAGATTGACT
TGTTATAACCAAAATGCTTTCTTACACATATCTTGGGCATTATTTATTTTGCATATGCTT
CCAATTCCATTGTGGTGTTAGGGTATGTTTAAATCATAGGTTGTTTAAATCATAGAATCT
TAAAAAACAAGATAACCAAAAAAAATTAAAAAAAAAACGATGAGGATGAGCTTAAGAGAA
TCTAATGATCTCACAATCTACTCTCTCTAGAACTTTCCTCACAGACACTCCCCAACATAA
ACTAATCACCCAGATCTTTTTCTTCGGTTTAATTCAGTTGAAAAAAAAAATCTACAAACC
ATTACAATCTCAGAAGAAAAACAAAAATCACAGAGAGAAGAGAAAGCAAGAAAAAATCAG
TATCAAATGAAATGAAAAAAAAAAACTGTTGCAGATCCCACAGACACTAAAAGGACAAAA
AAGAATTCTGTGAGTAACGTTGCATGAAAAATACAATCTATGATAACTCACAGGAGAAGA
AATATAAAATCGGAATAAGCCTGTATCTATTAAGAGTTTGTGTATTATTAAATTATTGGC
ATTTACTTACTCTTCAAGACACAAAGGACCAGAACAAATTGGAACTTACACGATTTAAAG
AAAAAATGTGGTAAATCCCCTTTGCTTTTGGTATAGAGTTTCATACAATGAAGGAATTTT
ATTGTATATTTTATTGAATGAGATGACTATAAATCATATGCTTCTTCATTCTATAAATTT
TGCAATGAAGTGGAAATTCTGATTTTGAAAAATGCTGTTCCTTTGAGGTCTATCCCGATG
GGGCTTCGTTAGTAGCCACACATCGTTGGAAACGCCTCATATAGTAACTTGTGGTTTTGC
TTGACTCGCAGGACTGTTTGTTAGGTCTGTGGGAAGGAACTACAAGACAGCTAACAAAGT
ACAAAACTGATGTGCAATTTTGGTTTTGTTTCTAGAAGCACTGGCATTTCCTTCATAAAG
ATTAGGATTCTGAGTGTTAGGAATGGACATGAAAGACTCTACAGAGATGTTGGGTGTCAC
AAGGAAAACCTACCTTAAAATGGTTTTTAAAGCTAATTGAAGAAGGGTCCCTAAATTAAA
GTAAATTGAAGAAATCCACAAATCTTCTGGCTAAGAACTTAGAAGTTGCCAATGACTGTT
GGAAAAGACAGATAAAAGAGGGCTAAAAAGCACAACTGGATGCCCTTGAGAAAGGGCTAT
TTTCAGAGTGCCTGGATGGACAGCAAAGAAATCAAACCAACCACTTAAATAAAAATTTAT
TGACAATAAATAATTTTATACATTAAAAAAGAAAAAAAAGAAAAATGCTGTTCCAAATAT
GGATATTAACACTGATCCTAAAAGTAATAAATGATTACTCATATTTTGGCCACAGACTCC
ATTTGTTACACAGTCATGCCACTGATTAATTTTGATCCATGCAATATTATATTTAGTATT
TCCAACAATCTAATGACTGTGTCAATTTTTTAGCCCCAATATCTATCTATAAAAGTGACT
ACAGCTCAAATGGTTATGAAATATAATGTGGCGATATAATTGTAATATATTGTGGCAGGA
GTGAGGGAATACCTGGCAGGCCCACGGCAAGGTGTTCCCCCAGGGAATCATGCCATGGAA
GAGACCTAATATAAAGATTTATTGTGGAGCAAGGGAACTGGGACCTGGAAGGGGATAGAG
GCAGGGAATGGGGGAAGCAGTGGAAAATGGACAGAAAGAGAGAAGAGAAGCCAGTTGGGC
ATACTTGGGAAGAGAGGGACGGGGGGGGGGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAG
AGAGAGAGAGAGAGAGAGAGAGAGAGATACAGAGCAACAGAAAGAGAAACAAAGAGAGAC
AAAGAAACAGAGAGGGGGGAGGGGTTGACACT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved