Rattus_norvegicus Locus Mono:278:SNORA24
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Mono:278:SNORA24
Rattus_norvegicus
Mono:278:SNORA24
20
SNORA24
1001..1129
2129
CATATAGTAATAGTGGTTCTCTGCATAAAGTCTCTGAAGTTACCATTCTAGACTAAAGC
TTTGCTTTAAAGTTCTCCCATTCACTAACCGGTCACCGCATTAGCCATGGGCTCCCAAAA
TCTTCCATGGCTCTGGCTTCCTTCCTCTAGCTTTGGAATAAGCAATCTCTCAATGGAGGA
AGGGAATGTTCCAGAATGTTGGCTTCCAAACACATAAGCTCGTCCTTCGTGGCGGTTTGA
ATGAGAATGGCTCCCGTAGGCTCCAGCTGGTGAAAAGATCTGTGAAGGATTAAGAGGTGG
GACCTCGTTGAAGGAGGCGTGTCACCGGGGGTGGAGTCTGATGTTTCAAAAGCCCATGCC
CCGCCCCCTTCTGTCCAGTGCTTGTGGTTCAAATGACGATCATATCCGTCTGGAACTGTG
AGCGCCAATAAATATTCTCTTATAAGTTGTCTCTTCGCAAAGATAGAGATGTAACAACTA
AGGTATCGTCCAGGATTCTTCTTCCACGGCATCTTTCTGCTGCTCTCTGACATCCCAGTC
CTCTGACCCCCTCAAAGCAAAGGCAAGTTATGTTCTCTGTCGCTCAGTCAACATGCTGCT
GTTGAAAGCCCTCCTCTTGGCCACTGGTCTCCATCGTGGCATAGGCTCCATAAATCCGTA
TCCTCTTTTATCTGTTTCCATGATTGTATTTCCCGACCCAAGACAGTAACAAATGACACA
CAGTTACTGACTGGTGTTTCTTTGGATGAATTATCTCTTCTAAAGAACTTGGGTGAAGGG
CAGATATATCATTCTTCCTTGGAATAACTCGATTGAAGCCCCATTAATCTCACACTCACT
GGCCAGGATGAGCTTAAATTATGAATGAAAATCCAAGAGCAGTGATAAGAGAACACAGGA
CGGGCCTCAGACACTCGAAATGATACCGCTTTTACCTATAAGACGTGTCCAGGTCAGTTG
ACGGCATAGGTTGTATTGTTATATTGATAAGAAAAGATAGACTTCAGGTATCTTTGTGAC
ATGTCAGGTGTGGTGACCCCACTTCATACCACGGAAGAACATGTTCCTGTTTGTGCAATG
TTATCACCAGTTAATGAGGTGTCTGATTCTGATTCACGTAGATAACATTCTTCACTGTAA
AAATCATAGGTCCTAAAAGTACAACCCAAGCCTCCTGACTTCTAGACCTCTATTCTTACT
ACACATAGGTTAGAATGCTCAGGGACCACCCAGTTACCAACAGAGCTACCAACCAGATGG
TGCTCTCTTACAAAAAATAAAAACCTTAGGTTGTCCACATCAGTCCTGGGTTGTGGCACT
AGAACATTCTGCAATTAAGGTCCATTTATAAATGTATTCTGTCCTCCATAAACCTCCTGT
GTTAGGTTGAATATGTTTGGCCCAGGGAGCGGCACTATTAGGAGGCGTGGCCTTGTTGGA
GTGGGAGCGGCACTATTAGGAGGCGTGGCCTTGTTGGAGTGGGAGCGGCACTATTAGGAG
GCGTGGCCTTGTAGGAGTGGGAGTGACACTATTAGGAGGCGTGGCCTTGTTAGAGTGGTA
GTGGCTGTGTAGGAGGAAGTGTGTCACTTTGGAGGTGGGCAATGAGACCCTTATCCTAAA
AGAGTCTTCTCCTGGTTCCCTTTGGAACAAGATATAGAACTCTCAGCTCCTCCAGCTTCA
TGCCTGCCTGGATGCCGCCATGCTTCCCGCCTTGATGATAATGGACTGAACCTCAGAACC
AGTAATTCAGCCCAAACTAATTGTTGGCCTTTAAAAGAGTCATGGTGTCTGCTCACAGCA
ATGGAAAACTCTAACTAAGACACCTTGGTGATATAATTACTTTCACTTAAAAAGAAACTA
AAACAGACTGGCTTCTGCTTCACTGTGCAGCATGAGGATGATCTTGAACTTCTGGTCAGT
CTGCTCTTACTTCCCTCATCCTGAAATTACCAATTAATCCCACAACACTTAGTTTTCCGT
TATATTTGGGATGGACTGGATTTCCTTGTTGCTAAAGAAGCATTCTCTCAACTGAGGTAT
ACTATATAACTCCAGCCTTTCAGTTGCTATTTTAATTATCAAGCAGCCTTTTTAATACCT
ATCCTAGCTTACCAACTCTTTTTTAATTAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved