Rattus_norvegicus Locus Mono:440:SNORA28
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Mono:440:SNORA28
Rattus_norvegicus
Mono:440:SNORA28
16
SNORA28
1001..1118
2118
AGGTTCAGTGCTTGTCAAACTGACTGAATTGGCTGAAAGATCCTTCAAAGATGTCTTCA
TTACCGGTTCTTCTGGCTGCTCTCTCTCGGCACATAGTTCTGAGAGTCCCTTTCTTAGGA
GTCTTCCTGGTTCATGTCTGTCTCTACGGATCCTCCCCAGTCAGAACACAGCCCGAGCAT
GGCGTCGCTCTCCTCAGCCCTCAGCATGAATTGTCTGATGCTCTGAAGAAAGCTGGCTAC
TGCAGGAGACTTTAGTCCGCCTCATTTTTTTTATATTTTTATTGGATATTTTCTCTATTT
ACATTTCAAATGTTATCCCCTTTCCTGGTCACCCCCTGAAACCCCAATTCCATCCCCCAA
CCCCTGCCTCATGAGGGTGCTTATCCACCCACCCACTCCCTCCCGCCTCCCCACCCTGGC
ATTCCCCTACACTGGGGCATCGAGTCTTCACAGGACCAAGGGCCTCTCCTCCCACTGATG
ACTGACAATGCCATCCTCTGCTACATATGCAGCTGGAGCCGAGGGTCGCTCCATGTGTAC
TCATTGGTTGGTGGTTTAGTCTCTGGGAGCTCTGGGGTGTCTGGTTGGTTGATGTTGTTG
TTCTTCCTATGGGGTTGCAACCCCCTTCAGCTCCTTCATTCCTTTCTCTAACTCCTCCAT
TGGGGACCCCATTCTCAGTCCAATGGTTGGCTGCAATCATCCGCCTCTGTATTTGTCAGG
CTCTGGCAAAGCTTCTCAGAAGACAGCTATATCAGCTTCCTATCAGCATGTACCCCTTGG
CATCGCCAATAGTGACTGGGATTGGTGACTGCATGTGGGATGGAGCCCCATGTGTGGCAG
CCTCTGGATGGTCCACCTCATTTTTAGACCCTGGTATCCCATGCTCAAACCACCAATTAA
AGCACTAAACACCTACCTCAAGACACTCTAGGCCTTCACCATCTGGTGCCTTAGAAAGCT
TACTTTAGAGATTGCATTTTTTTTTATTATCTCAGTTAATGAAGGGATATTTTAAAGCAT
TTAAAAAGTGAGGCTGATTGAGCTTGCTATAGCAAAAATGTCTAGCCTATCGCATGTTCT
CTTCCTCATGAGACAAGTCGTTACATAGGCTCAAAAAAAGTGAGGCTAAGCCTCAGGAAC
TAATGTGTATGGACAGCATGTGTGAGAGTCTGATGGATAGATGGATGGATGGATGGATGG
ATGGATAGACGGACGGACAGACGGACGGAAGGACAGACACACTCGAGGGGGAGTGAGATC
AGGACACTTCCCCATCCTAGGCTTCTCCTCTCTCTATAGACAGAATCAATCATTTGGTTT
CTATTATTGTTTTGCTTTTTGTTAATTTTTATTATTTTATGGGTATAAGTGTTTTAACTG
CATGTATGTCTCTATACACTGCGTACACAGTGCCTGCAGAGGCTAGAAGAGGGTGTCAGA
TTTCCCAGAACTGAAGTTAAAGTTGGTTATGAGCATCCATGTTTGAGGCTAGCCTGGACC
ACAGAGTGAGAGCCTGTCTTAAAACTAAACAGTGCCCCAAAGAATACAGGCAAGGAGGCG
GTGGTTCCAATGCCGGGAACTGAACCCCAGTCCTCTGCAAGAGCAGCAAATGCTCTTAAG
CACTGAGCCATCTTTTTACCCCTACTGTTAGATTCTTTTTTTTTTTTTTTTTTGTTCTTT
TTTTCGGAGCTGGGGACCGAACCCAGGGCCTTGCGCTTCCTAGGCAAGCACTCTACCACT
GAGCTAAATCCCCCAACCCCTGTTAGATTCTTTTAAGGACCACATACATATACTTATTTT
ATATATAGTATTATCTATATTTATAGATGGGTGTTTTGCCTGCATGCATATATGTGCACC
ATGTGCATGCAGTGCCTGCAGAGGCCAGAAGGGGACACTGGAGTCCCTGGAACTGGAGTT
ACAGAAGGTTGTAAGCTACTAAATGGGTGCTAGAAACCGAAGTCAGTTCCTCTGGGACAG
CACCATCTCTCCAGGCCCCAAGCCCCATCAGGTGCATAATGATTTATTTTTTGCACTGCT
GGAAACTGAACTAAGGCCTCACGCCTGCTCGGCAAGCCCTCTGGCACAGGGCACTAACCC
AGACCCCCGCAGGAACCTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved