Rattus_norvegicus Locus Mono:23:SNORA21
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Mono:23:SNORA21
Rattus_norvegicus
Mono:23:SNORA21
X
SNORA21
1001..1104
2104
TCCCCAGCGAGCTCGCACAGAGCGCCCTCGGGCGGAGATCTGGGGAAAGGCTCAAGGAC
TTACTGTTGGAGGAAGAAGTTCGGTTCCCGCCCCCTTGGTCACTGGGAGAAGTTTCTAAG
GCCAATGAGGTGGTGTATGGTGACTTTACTCTGTATTCTCGTGAATGTAGCTTCTGGAAG
CCGGGTATCTACAGATTTTTTTTTTTTGTGAAGCCGAACCTAGGAAAAGATTAGAAAAAA
AATCAGTATTTAAGTATCTTTGACATCTTATTATTCCTCGTGCGTTAAAAATAAGTGATG
TGAGTGCACACCATAGCCCAAAAGCTCGGATTACCCAAGATACAATCCACAGACCACATG
AAGCTCAAGAAGAAGAAGTACAACCAAAGTGCAGATGCTTCAGTCCTTAGAAGGGGGAAC
AAAAATATTCATAGGAGGAAATATGGAGACAAATTTGGAGCAGAGACTGAAGGAAAGGCC
ATCCAGAGACTGCCCCCTCCTGGATATCCAGTTCATATATATACAGCCACCAAACCCAGA
CAATATTGCTGATACCAAGAAGTGCATGCTGACAGGAGCCTGATAAAGCTGTCTCCTGAG
AGACTCTGACAGACCATCACAAATACAAAGGCAGATGTTCGTAGCCAACCACTGAACTGA
GAATGGGGTCCCCATTGGAGGAGTTAGAGAAAGGATTGAAGGAGCTGAGGGGGTTTGCAA
CTCCAATACCAACAAAAATACCAAGCGACCTGGAGCTGACAGGGACTAAACCACCACCCA
TGGAGGGACCCATAACTCGAGCTTCATATGTAGGAGAGGATGGCCTTGTTGGACANNAGT
GGGANANNNGTCNTTNGCCCTGNCAAGGCTGGACCCCCCCCCCACCCCCGTGTAGGGGAA
TGAGGGGGAAGGCAGGAAGGGGTAGGTGGGAGAACACTCTCATAGAAGAAGGGGGATGGG
GGATGGGATAGGGGTTTTATGGATGGGAAACTGGGAAAGGGGATAACATTTGAAATGTAA
AAAAATAAGGGACAGTGAAAACACCACTTTTGGGTGAAGTGGCAACGTGATGTGTTGTTT
AACTTCAATCGGTGTTGTGACACGATAAGAAAAAAATGTAAAAAAAATCCAATAAAAATG
TTACTTCTGAAGATTTACATAGAAAATAATCCTGAAAAATTAGACCACATAATGAAATAT
TGAGTAAAAAATAAATGATGTTTTTTGTGAGTGATGTTTCCCACGAAATCTCTGTAATTG
GGAGGCAGAATCATGAATTGGCCAACCTGGGCTGTGTATAGACATGCTGTATTAAAAACA
AGACTGAGAGCACAGTTCTTAAGTAATGGCAGAAACCAAAAGGTAATGAATGCATTCTAG
TGAAGGTATTTTATTTGACTTTACCTTGTATTGTTGTTGTTCGAGACAGGGACTCACTAT
ATAGGACTTGGCTGGCCTGAAATTCATGGAGATCCATGTAAGTGTCTCTTAAGTACTAGG
GTTAGAGGTGTCAGCCACTATATACCTCCCACCCATCTTTATTAAATTGGGTATTTCTTA
TTTACATTCCAATTGTTATTCCCTTTCTTGGTTTCCAGGCCAACATCCCCCTAACCACTC
CCCTCCCCCTTCTCTATGAGTGTTCCCCTCCCATCCTCCCTCCATTACCGTCCTCCCCCC
AACAATCACGTTCAGTGGGGGTACAGTCTTGACAGGACCAAGGGCTTCCCCTTCCACTGG
TGCTCTTACTAGGCTATTCATTGCTACCTATGAGGTTGGAGCCCAGTGTCAGCCCATGTA
TAGTCTTTGGGTAGTGGCTTAGTCCCTGGAAGCCCTGGTTGGTTGGCATTGTTGTTCATA
TGGGGTCTCAAGGCCACTCAAGCTCTTTCAGTCCTTTCTCCTATTCCTTCAACAGGGGTC
CCGTTCTCAGTTCCGTGGTTTGCTGCTGGCATTCGCCCATGTATTTGCCATATTCTGGCT
GTGTCTCAAGAGAGACCTCTATCCGGTTCCTGTCAGCCTACATTTCTTTGCTTCATCCAT
CTTACCTAGTTTGGTGGCTGTATATGTATGGGCCACATGTGGGGCAGGCTCTGAATAGGT
GTTAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved