Rattus_norvegicus Locus Poly:27:SNORA17
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Poly:27:SNORA17
Rattus_norvegicus
Poly:27:SNORA17
1
SNORA17, SNORA17
1001..1125, 3474..3598
4598
TGGAAAGAACCCAGATGCCCTTCAACAGAGGAATGGATACAGAAAATGTGGTACATCTA
CACAATGGAATATTACTCAGCTATCAAAAACAACGAGTTTATGAAATTCGTAGGCAAATG
GTTGGAACTGGAAAATATCATCCTGAGTGAGCTAACCCACTCACAGAAAGACATACATGG
TATGCACTCATTGATAAGTGGCTATTAGCCCAAATGCTTGAATTACCCTAGATCCCTAGA
ACAAAGGAAACTCAAGACGGATGATCAAAATGTGAATGCTTCACTCCTTCTTTAAATGAG
GAAAAAGAATACCCTTGGCAGGGAAGGGAGAGGCAAAGATTAAAACAGAGACTGAAGGAA
CACCCATTCAGAGCCTGCCCCACAGGTGGCCCATACATATACAGCCACCCAATTAGACAA
GATGGATGAAGCAAAGAAGTGCAGACCGACAGGAGCCGGATGTAGATCGCTCCTGAGAGA
CACAGCCAGAATACAGCAAATACAGAGGCGAATGCCAGCAGCAAACCACTGAACTGAGAA
TAGGTCCCCCGTTGAAGGAATCAGAGAAAGAACTGGAAGAGCTTAAAGGTGCTCGAGACC
CCAAAAGTACAACAATGTCAAGCAACCAGAGCTTCCAGGGACTAAGCCACTACCTAAAGA
CTATACATGGACTGACCCTGGACTCTGTCCCCATAGGTAGCAATGAATATCCTAGTAAGA
GCACCAGTGGAAGGGGAAGCCCTGGGTCCTGCTAAGACTGAACCCCCAGTGAACTAGACT
ATGCGGGGAGTGTGGCAATGGGGGGAGGTTTGGGAGGGGAACACCCACAAGGAAGGGGAG
GGGGGAGGGTGATGTCTGTCCGGAAACCGGGAAAGGGAATAACACTTGAAATGTATATAA
GAAATACTCAAGATAATAAAAAAAAAAAAACAAAATAAAATAAAAAAAAAACAAAAAAAC
CAAAACAAACCAAAAAAAAAAAAAAAAAACAATTTACTTCTTCTGCCCCTAGAGGCCTTG
CAGGTGTGGCTGCTGTGTCACATGGGTGTCAGTAGGTGGCAGAGTGGAAAGAAGCTATGT
CTAAGCTCAGGGTTCTGACCTAACATTCCCTGAAAAAAGAGATCCTGAGATCACCTCCAG
TCCGGCACCACAGGTCTCAGACAAGAAGCTATCCTGAGTTGACCACCAGTCCAGAGGTGC
ACAGTCTGGGAGTGGGGGGCAGACCATGCCTGAGATGATACTTGCCCCATGCCATAATAT
ATGAGCACTGCATAGAACTCCTCCTGAGACAATCCCAACACTCAGAGACCCTGGGCACCA
CTATGAGGAGCAAGTAAGTGGTGGAGAAATGGAAGAGAGAGAGAGAGAAAGAGAAGGATG
TGGGCACAATGAACATTTTGTTTAGTTCTTGCATAGTCAAGATTCCAGTAGCCACCCAGC
ACAGGTGGCCTCCATCGGCAAAGGAAAAACTAGTTTCTGCTTGCAAGCTGAGCTCTCATA
TCTCTCTTCCTGACCTTGCATGTGTTATTTTGAATATAATGTATTTTTAAATTGCTGTGC
CGTTTTAAATATGTAAGGGAGAGCTGAATTAAATATTATTTGTGGCATAGCCTGCCCTGC
AACAGGCCTCTAAATCTGATCCCTTATATCAGGTCGATGCCTAAATCCCATTACTTGCGA
TTGCAAATGACGATGTTTGCAAGATTGTGGAGGCACATTTGGGGACAGCATCAAAAATTC
AGCCTATAATGTTAACGTTGTTTGAAAAGATCTTGATTTTTTTCCAGAAAGCAATCGCAA
GGCCTCCTGGCCATTCCTTAAGTCTGTCTCTGTCAAGGATAATGCATTAATGGCTTGCGG
ATGGCTCGGCAGTAGGTTCTTCGGGAACCATAATCCATACTCAAAATGAGTTCTCAGATG
CATAGAAAGATTAGCTTTGAAGCTAGATGTAGGCTACATTCTAGGGCGGTGCTTCTCAAC
CTTCCTAATGCTGTGACCCTTTCATACAGTTCCCTCATGCCGTGTTGACGCCCAATATCA
CTTTACTAAACCAGCATAAATCCTAATTATATTTTAAATATTTGTGCCCTTATACTCACA
AATAAGTGTAGCCCTTCCCTCTCATCGAGGAAAACCGCTGTTGCAACAGAGGAAGATCAT
TATAGAAAGCAACAGCTAACCACGATGGGGAGCGGTGGAGCCCAGCTCCAATAGATATAC
CCATAAAGGATCTCCTTACCTAAAGCTCAAGGAACACTGAGGGGGAAGGGGCAGGAAGAC
TAGGAGCCAGAGGACCAAGGAGTTTGCTCTGAGACTGTGGATCTTAGTAAATTCATAAAT
GACATGCACCCATGACTGAGTAAACATGGGCTGAGCAAGGANNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTCCACTATGTTCATCGCAGCCTTATTTA
TAATAGCCAGAACCTGGAAAGAACCCAGATGCCCTTCAACAGAGGAATGGATACAGAAAA
TGTGGTACATCTACACAATGGAATATTACTCAGCTATCAAAAACAACGAGTTTATGAAAT
TCGTAGGCAAATGGTTGGAACTGGAAAATATCATCCTGAGTGAGCTAACCCACTCACAGA
AAGACATACATGGTATGCACTCATTGATAAGTGGCTATTAGCCCAAATGCTTGAATTACC
ATAGATCCCTAGAACAAAGGAAACTCAAGTCGGATGATCAAAATGTGAATGCTTCACTCC
TTCTTTAAATGAGGAAAAAGAATACCCTTGGCAGGGAAGGGAGAGGCAAAGATTAAAACA
GAGACTGAAGGAACACCCATTCAGAGCCTGCCCCACAGGTGGCCCATACATATACAGCCA
CCCAATTAGACAAGATGGATGAAGCAAAGAAGTGCAGACCGACAGGAGCCAGATGTAGAT
CGCTCCTGAGAGACACAGCCAGAATACAGCAAATACAGAGGCGAATGCCAGCAGCAAACC
ACTGAACTGAGAATAGGTCCCTCGTTGAAGGAATCAGAGAAAGAACTGGAAGAGCTTGAA
GGTGCTCGAGACCCCAAAAGTACAACAATGCCAAGCAACCAGAGCTTCCAGGGACTAAGC
CACTACCTAAAGACTATACATGGACTGACCCTGGACTCTGTCCCCATAGGTAGCAATGAA
TATCCTAGTAAGAGCACCAGTGGAAGGGGAAGCCCTGGGTCCTGCTAAGACTGAACCCCC
AGTGAACTAGACTATGCGGGGAGTGTGGCAATGGGGGGAGGTTTGGGAGGGGAACACCCA
CAAGGAAGGGGAGGGGGGAGGGTGATGTCTGTCCGGAAACCGGGAAAGGGAATAACACTT
GAAATGTATATAAGAAATACTCAAGATAATAAAAAAAAAAAAACAAAACAAAACAAAAAA
AAAACAAAAAAAACAAAACAAAACAAAAAAAAAAAAAAAAAACAATTTACTTCTTCTGCC
CCTAGAGGCCTTGCAGGTGTGGCTGCTGTGTCACATGGGTGTCAGTAGGTGGCAGAGTGG
AAAGAAGCTATGTCTAAGCTCAGGGTTCTGACCTAACATTCCCTGAAAAAAGAGATCCTG
AGATCACCTCCAGTCCGGCACCACAGGTCTCAGACAAGAAGCTATCCTGAGTTGACCACC
AGTCCAGAGGTGCACAGTCTGGGAGTGGGGGGCAGACCATGCCTGAGATGATACTTGCCC
CATGCCATAATATATGAGCACTGCATAGAACTCCTCCTGAGACAATCCCAACACTCAGAG
ACCCTGGGCACCACTATGAGGAGCAAGTAAGTGGTGGAGAAATGGAAGAGAGAGAGAGAG
AAAGAGAAGGATGTGGGCACAATGAAGAAAGGCAGAACTCGAGACTCTAGGGTAGTGAGG
AAGTCTAATGTAACTGCTAACCTCAGACCATGGTGGGGTCTTGTCCTCTGCTGCCACTGG
GGACCTCTAACCCTGCAGTAATTGGGTTTTCTTACTACCAAAGGCCAGGCAGATGTCCCT
ACTCTGGGCTACCAACCTGGGAACATGCTGATATCTGAGGGCTGTGCAGACTGGCCCTAT
CCCTCACCCAGGCATCCTGGAAGAGCTGATCCTCTGGGTATGAGAACAAGAGCACTGACT
CTGCCCTTAGCCAGCTCTAGTACTCAATAGAGCCACCCTGACTGTTGTAGGAGTTGCAGG
AAAGCCAACCCCAAGGACAGGAGTATGGGGGAGCTAGCTGTACCATTTGTCTCCAGTGTG
GTGGTATGGACTACAGTGAGATACCCTTCTCCCCCCTACTCACCCCCCTCTACTCACCAG
TGGCAGGTAGGAGATCTGGTCCTGGGGTCATGAGATCAAGAGAGCTGACCCTACACCTCA
CCAACTGCAGCACCCCAGAAAGTGGGCACTGCACCTTGCCTGAGCATCACACTAGAGCTG
ATCCTGGTGCCTGGGCTACTGGAAAGCTATCCCTAAGGGCATGAGAATGGGAGAGCTGGC
CCCATCATTTGTCTGCCAGGCAGTGACATGGTCCAAGGAGACAGGCCCTTTCCCCTCACC
TCTTGCCACCTACAGCAGGTAGGAGCACTGGCTTTAAGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved