Rattus_norvegicus Locus Mono:180:SNORA44
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Mono:180:SNORA44
Rattus_norvegicus
Mono:180:SNORA44
5
SNORA44
1001..1121
2121
TGTGCTGAATGCATTTTTCTACCTCAGTGCTTAAAATAAAGAAATGAGTCTGAATCTTG
TCAACAGTTTTTGATTCGTACTAACCATAACAACTATAAAAATGGGACCTTGGTGTCAAA
AAAGCTAAGGTTACAGCAGTGACTCACTAGCTGAGTATTTGAAACAGTCAGCAGCAGGTA
GGGTACGATTGTCTAAAAGCCTTCAGTGAGAACATCCAGGGTGTGTGGTGTGTAGTACAG
TACAAGAACAGGGTGAATGACAGGGCCATTCATTTCTTTCAGCTTTTCAAACTCTTTCAC
AGGGGACTTGAAAAACCCTTAAATGTGTTCAGGACATGGCTTGATAGTACAGGACTATAT
TGCATTACATACACTCAGGAAGACAAGAAAGAAGGATTATAGGTTCCAGACTCGGTAACT
TAGCAAGAATTTATCACAAATTGAAATAAATGTCCTGAGAATATAGCCTAGTGGAGAGCA
TTTGTCTCACATGCATAAGGATATGAATTCAATCTGCAGTCCTTCAAAAGGGAACACAAA
CATAAAGTACAGGTGTGTGGACAAAGCATAGCATATGCAACAAGGGTTCTCGTATGTGTT
TATATTGGCTGACACAGAATTGAGTGCAGAATTTTTACCTAACCCTGCCAATTAAGCCAA
CTGAACTTTTTTTTAACAAGCATGGCCTCTGTGACCCACACTTTTATCTAAAATCCAGCC
AAATGTGTCTTAAAGCCTGACATTAATAAGTCATATATTAAGGTAAATTTTTTTTTGAGC
TGTGGTCTGTAAGAAACACAAGGATTACTTACACTATTTTTTTCTTCATGCTTTAAGCCA
AAATGCCACTAATACCTCTGAATTCAGGTGATGGCTAACTATTCTCAAGCCATCTTGTTG
GACTTTCAAAGACCTTGATACATATGTGTAAGAAACTTGAAGCTCAGACCTATGAAATAA
TTTGACTGAAATAAATGCTGCAAAACTGGAAAGAGAGAAAATAAGTGGATGTTAAAAAAA
AAACCTGCTTGGGATCTCCAACTGCATGCCAGAGTAACGGAGAGACTTTGACAGCCCAGG
TTATCACAGTGCCTGCTGTTGCCACTCAGCTCTCCTATATGTTTTTCCACTGGAGTTATG
AGCTGCCTGTCCTTCTGTCCTGTGGTATTCACAACAAACTTTCCTTCTGCAGTGTGCACT
TGGGCGGTTCTTGGAAGAGTGAGGAGACAGCCTGTCAGCCTCTGCTCATTAACCTAAGGA
CCATGTGACCAGTGAGGTGGCCATCTTGTGATTTGGTCTGCATTATTTGTTGGAAAAATG
CCAAAAGAAGATCACACTGGGATTTAGAAGTTTCTGGCTAATACTTAGCCAGGTAGCCTT
TTGTGGCCAGATTGGTCTACAAAGAGAAACAACATTTTGGAAAAGTGAAATACCTTTGTA
ACCTAACATGCAATTGGTTCAATAAAGACTTCAAATTTCAAAAAAAAAAAAAAACCTGCT
ATTCTATTAAAGAAATCAATAAGGTGAAAAACCCTTATTACATAGGTAAGCAACAGTATC
AATGCAATTCTTATCAAAATGCCAGTGATTTTAAAAAATAGAAAAAAAAATCATCCTGAA
GTTCAGATGACACCCACAGAGCATTCAAATGGGCATAGGAAGTTTGAACAAAAACAACAA
AAATCTGAAAATAGTGTATTTCTTTTCTTAAAAGTATACTGCAAAGCTATAGAAATCCAA
CATAAATGACATACAAAGGGATTTCTAACAAAAAAGAATAAACAGAATGCTGAGACATAA
CTTTGTAGGTACATAATTAACTGATCTTTGACTAGAGTATAAATAACACATAATAAAGAA
AACACCATCTCTTAAAAAAAAACAAAAAAAAACAAAAAACAAAAAACAAAACTCGTGTTG
AAAAAACTAGACAAACATTCATAGCCAAATAGAAAATGTAACCACAGACATGCAGTTTTG
TTTTTTTTATTAAACTCAGTGGCTCTCAAGACCCTTATCTTCTCAGTTAGTCTGTCTCTT
GAAAATTCATACTATGACAACATTTTAGTAGATTGAGAAAAGAGGAGGTAGGATGTAGAT
GGGAGAACTAGATCACTGTGTC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved