Rattus_norvegicus Locus Mono:45:SNORD89
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Mono:45:SNORD89
Rattus_norvegicus
Mono:45:SNORD89
9
SNORD89
1001..1115
2115
ACACATATAAAGAGGTTCCATTTTGCACACGTAGCATAGGGGAGGTCTTTAGTGGGTTG
GTTCCCTGGAACAGCCATCATTAAAAAAGCAGGTCCAGTACAACTTTGAGGTTTTTGTGT
AGAGTAATAAGGGCAGTTTCATGGTGTGTGTCTCTATTTGTGTGGACAACATCTCTTAGA
GCTGGTTCTGAGACATCACCATGGTACCCATATACCGTCTTCACAGGCAGAGAAAGCATC
AGCATCAAGGGCTTGTCTCCAGAAAATTGCAGAAAGTATCCCAACTGGAAGCCAGCACCA
AGAAAATACAACTTTAAAGGCTAAGTTTATCCTTAGAGCCCTTCTTAAGACATAATATTT
GATAAAGTGTCTTACCAAGCTGTTTTTCTCCAGTTTGATTTTTAGCTGCTCCATAGTAAA
ATACGTGGTGAGTTTTACTGAAAGAAATGTACAACCAGATGACTATAATCCGCTGTTGAT
GTAGAAAATCATACTTTGAACACTTTTTGGAGTCTCAAAGTTGGCTTTATAAGTTAGCAC
CAAACCTGTGTTCAGTGCAAGTAGGAAAGCATGAATTTGGCATGTTAGTGCTTTGTTTTT
TTAAGACATAACAGGGAAAATGCTATAACCATTCTAACAGCCGATGAGGCTTGCTTTTAC
AAAAGGATCTTGTGATCGAGCAAGGTAAGATGGTTTTAATCATTTAGTCATTACAGAAAA
AAAAATTTTTTAAGGCAGGATCTGTTTAATCTGAGTTTGAACTCACCATCCTTGTGCCTC
AGCCTTCCCAGTGGTGAGATCACTTCTGACTAAACGGTGATGTGAAGATTGGAGGTTGTT
TGCTGTGGTTCCCGCTTTCCTGGCTTTCGCCCAGCAGTACTGACTTTAGTTCTCCCAGCA
GAGAACTGGAACAGTCACCACACTCTACAGGTAATTGTCTCTCACATGCTTGATTAACTG
GGATCTTGAACCTTTCTTCCCACTGACTGCTTCCCAAGGCTGCTGAGGAATGATGACAAT
AAAAGGCCGAATTGCAGTGTCTCCATCAACAGTTTGCTCTCCGTGTGGGCACACGATGAC
AAAACCTCCTGAAGCGAGTCACTGTCTGACCTCAGTAGTGCCAGTGTGGAAGCTTCCTGC
CTGTGCTGAACTTCCCAAGTGTGGGGTGGGGGTGGGGGTGGCAGGAAAGCCTTCCTATGC
TAAGAAAAACAATCAGGGTCTTAGATTAGCTACGCTGACCAAGCAGTGTCAGTGTAACTT
TAGAACACTTATCAAATCAAGGACTGCTAGAATTGTAAACGCAACAGTAGCCCTTCTAGA
ACAAGATAGCTAAATATGGCAGCAATTTCCTTGGAGAAAGTTGATGTTGTTTGCTCAAGA
AAGGACGAAGTTTAATCAGTGTGTATCTATTATTATCGAGAACTTGAGGACATTTAGACA
AAAGCAGTTTTACAGATCAGGAAAACACTGTTCCACCATGTCTGTCCTAAGCACCAGATG
TGGGCCTGAAGTAAAATCAATGCGGTAAAATACAATGTTGTGCTTTTATGATTCAACACA
TTAGAAAAGCTACCTTTGCCTTTTCCAGCTCAGTCTTGCCTCTAAAACCAGAAACATTGG
TCAACATTTCATTTCCAAAAATAGTATTTGCATCACTCATTATAGTGAGGTCTCTGCCAT
GAACCCACTTGCCTCCTCCTATAGCAAAGTGTAGAACAAAACCATGAGTTGAAGTTATGA
GGAACAGAGTCCATTTTCTGTGGGCCCATTTTAGTTACAAATCTCAAGCTTTAGTAAATC
TTGGATTATGCCTAATATAGACGATAGTAACAAGAAAAAAAAAACCATCAGAATGAAATC
AGCAGTAAGCAGTTGCTAAGATTTGATGAACATGGTAAACGTTTTTCTTAATTACTAATT
TCTCAGATATCCTTTGTTACTAAGAGCTATTCAAAATGTTACATAGATTGTAAGACTCAG
AAACACAACTAATTACTATAGAAATGTTACCTAAAATATATAAAGCTTGCTACCTAAAGT
GTAAATAGAACATACCCTATAGACTAAGTGGTCTTCCGTACATTGCTTTATTAAGTCAGT
AATAATTATTTAAGTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved