Rattus_norvegicus Locus Mono:586:SNORD116
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Mono:586:SNORD116
Rattus_norvegicus
Mono:586:SNORD116
1
SNORD116
1001..1093
2093
TTATAGAAAAGGAAAAAAAAAAGGGTTCCAACTTTAGGCCAATGACTGGTGCAAGTATC
TGCTTCTTTCTCAGTCAGCTGCTGGAGGGCTTCTCAAAGGCAAGAATGCCAGGTTTCCAT
CTGTAAACATGTCATAGCATCAGTAGTAGTGTCAGGCTTTGGTGTCCCCTTCCCCCATGA
GATAGATCTCAAGTTGGGACACTTATTGGACTGCTTTCCCTTCAGTCTCTTCTCCATTTT
TGTCCCTGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNA
TCCTCGCCAGCATCTGCTGTCCCTTGAGTTTTTGATCTTAGCCATTCTCACTGGTGTGAG
GTGAAATCTCAGGGTTGTTTTAATTTGCATTTCCCTTATGACTAAAGATGTTGACCATTT
CTTTAGGTGTTTCTCCGCCATTCGGCATTCCTCAGCTGTGAATTCTTTGTTTAGCTCTGA
GCCCCATTTTTTAATAGGGTTATTTGTTTCCCTGTGGTCTACCTTCTTGAGTTCTTTGTA
TATTTTGGATATAAGGCCTCTATCTGTTGTAGGATTGGTAAAGATCTTTTCCCAATCTGT
TGGTTGCCGTTTTGTCCTAACCGCAGGGTCGGGAACCCCGATAAGAAAGGGGAGGGGGGA
GGGGGATGTTTGCCCGGAAACTGGGAAAGGGAATAACACTCGAAATGTATATAAGAAATA
CTCAAGTTAATAATAAAAAAAAAAAAAAAGAAAGAAACACTTGAATTACCAAAGGAACTC
AAAGTGCTCAGGTGTTGATGGAGCTCGCAGGAGTTCCCAACATTGAATCATGATCCTTTG
GGACCTGGTTCAGGCTCACTGCCTGTGGCTACTCCTGTGATTGGAGAATAGGCCCATTGG
TTCGTGGTAAAGGATGTGGATGTCTTGAATTCTGTTTGCTCGCCAAACCTGATCTAGTTT
GAGTACACTAAGTTCATAGCAGGGGGTACAACAGCGTGCTTGGATCGATAATATTTTCCA
ATAAAACATTCCATGGAAAGCTGAACAAGATGAGTGAAAACTCAATACTGCCGCTATCAT
CGTGACTGAGGTCCAGCACCTGGGATCACAAATGTCACTGAGGGACTCACAAGGCCTCCA
TTCATCTTGCGAGACTTGGATCCAGTAAGAGAGCCTTCAGAATATTATTTGCATGCCTAA
ATCACCAGAAATCATGGCCTATATCAAGGCTTCACCTTTTGCTTTATTAATAACATGCTT
TCCATTTGAGGAGATCATAGTCAGTATCTTGGAGGGTACCCCAACCAACTCCATCCTTCA
ATTATGTTCAGTAGGCTGTGAGGCAAATGTAAGTATAGCGGGGGCAGTATAGTTCCATAA
TGTACACTGGAATGTCAGGAAATGTGTTTCGGTCCCTGTCTGAGGCCTTCGCATAAATGA
TAACCCTTCTGTTTCATAAAACAGAGATACATAAAGGGAAGGTTACAGGCGACATGTGGA
ATGAGGCAGTAGCAATTCTCCAGAACTATGGGAATGTGTACACTTCCTGTGTGAAAACAA
AGCTCTGGCTTCTTTTTTTTTTTTTTTTTTTTTTTTTTTGGTTCTTTTTTTTTTCGGAGC
TGGGGACCGAACCCAGGGCCTTGTGCTTCCTAGGTAAGCGCTCTACCACTGAGCTAAATC
CCCAGCCCCAAAGCTCTGTCTTCTTGAAAGACTGATTGTGGCCATGGCAAATAGGTTGGA
AAGAGACCCTTGAAATTTAAAGGGTTGGTATGTAACCTTCATGTCGGTGGTTTCTAGAAG
TGCCTGCTTTCAAATGTCCCAGGATTCATATCACCTTCATGGATTTATGTAGGACACCCA
TTTTAATCCTAGTTTCTATGTTTATTGTTGGGACATTTTTTCTCAGTCTATCCAGCTAGT
TTGCCAGCAATTCTTATGGATTGACTGAACCAAATTTGGTCTGGACATACATCTCATCCT
CTTCTAGGATCTAAGAAAGTGAGCATGCAACTTTGTTTCTTACACAGAGTCCTTCTACTA
ATTTTTATTTTGTTATAGCCATACAAGATAGGCATGGAGTGTCTGTGGGATTAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved