Rattus_norvegicus Locus Poly:4:SNORD12
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Poly:4:SNORD12
Rattus_norvegicus
Poly:4:SNORD12
3
SNORD12, SNORD12, SNORD12
1001..1092, 2380..2468, 2653..2743
3743
GGCGCTGAGTGGAACAGACAGGGACTCCAAGGCTAACCTGACACCCGGCCCGAGACAGA
GCGGGGCGCCGGCGGTCGCAGCGCCGCAGAAGCAGGTGCGAGATAGGGCGGAGGCCACTC
ACCGGCTCGGGTGCGTCCTCGGCAGGGCTAGAGCTCAGCTCTGGCCCTGGCAGGTCGCGG
CCCCGCCCGGCACCGCGAACTTTCGGTTTCCAGTCCCCGCAGCCCCTGGGCGGGGCGAGT
AGCCGGGTGGGCGGCCCGGAGGAAGAGGAGGCCGCGCAGGACGAGGAGGCGGTGCCGCGG
GCGCCAGCGAGAGGCTGGGCTCGCCTGCGCCCCCGCCCTCGGGGCGGGCGGAAGGGCGGT
GTCGCCTCAGCCCCCGAGGCGGCGGCTGGACTGGCGGCTCCCGAGGGCGCGGCTGAGGGG
AGGACGCGGCGGGGGGCGGGCTGACTGCGCCCCCGGTGGCCGCAGGTCTCGGCCGGCCCC
GGAGCCGGGGAGACGCGGCGGGCGGCTCGTGAGTGCCAAGCGCGACATGGCGCGGAAGCC
GAGAAGCCCTGGAGGCCCAGTGAGCACGGGGAGGGGCTAGAGACTGGCTGGACAACCATT
AGAGAGCTGGGGCCGGGAGGCTAGGGGACTACATTTCCCAGGACGCCAAGCGGTCGGGTC
CGGAAACGACGGACTTTGGGCTAAGTGCGCAGGCGCACGCGCCGCCGTGGTCTATATAAA
GAAGGTTCGCTCCCTTTTTCGTCCTTTGATTCCTGAGTCTCCGTGAGGTGTTCTCGTGGT
TACGATAGGTCTCTTCCCTGTGATATTCATTTGCAGATGGTGAGTTGAGTTCCCACAGCA
CAATTTTCCTTTTTCTTTTTTGGTAACTTCTTACCAAGTTTAATTGCTGGAGCCGCTCCT
AGTTCTCCGGGTGTGGCTTATGGAATGCCATCCTCAGGTTGACCTTGGAGGAGGTGATTC
GGGTGGAAAAGACGCCTTCTTGTTCAGCCTGGAAAGTTTTTGCTGGTGTAAATGATGACC
TCACTTTTTTCCCCGTCATATCGACAGTGCTGATGTCTTAAAACATTTGCCAGTTAGTTC
TGATAACACCGGCCTCCAGGAACCCTGGTCTGCTTTGTTCCGGTCGAGGGTAGGTGGTGA
TTGATACTTTGTTTTGTAGGCTGGACTGATCAAGCAGTACAGAATGGAGGTCGGAGGGAG
AGAAGGTCCTCCAGGGAGATGAGAAATCGCCGAGCACCTTAAGTCTCAAGGTACTCATTT
GTCTTGTGGCCTAATGTGGGAAACACGTGCTTTGAAAAGCCTTTAAAGGCGGGACGGTGT
GTGTGGGGGGAACACCCTCATAGAAGGGGGATGGCATAGGGTGGTTTATGAACGGGAAAT
TGAAGTCAAAAGACATTTAAGTGCGCTGTGATAGGAAATTAAATGCGAGTTAGTGCTGAT
ATTGTTTAAGTGTTGAGGATTGAACCTCCGTTAACCCTAAGCACACAATCCTAAGTATAC
GTCTTTTTTTTCTTCCCTAAATATCCTGATTGCTACTTGTAACTTTTTTTTTGTTCGGAG
CTGGGGACCGAACCCAGGGCCTTGAGCATGCTAGGCAAGCGCTCTACCATTACTTGGCAC
ATTTTAAATTCTCATTTCACATCTGTACATACAGATCCACAAGATGCAATGCTCTGTCCT
TACTCAACCTGCCCTGGTTGGTAGAACTGCCTGAGAGAGGGCAGAGGCAGGGTGCTTNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATTAGAGGGCACA
GCCATTTTTGGGCAGTGTCTGAGCCTCCTTGTCGAGTTGTTGGAATTTCTTTGGTGTATG
CATGATTATTTTTCCTTTTTAAAAAGCCGTGAAACGCGTTTACTCAAGTATTTGCAGCCA
GGTGCTTTTTTTTTATTTTTCCGGAGCTGGGGACCGAACTCAGGGCCTTGCCCATGCTAG
GCAAGCGCTCTACCACTGAGCTAAATCCCCAACCCCAGCCAGGTGCTTTTCAAAGCAGTG
TGATCATGTCTGTCCTCAGCTACTGTGTTCTGGTGGTGTCCATCCTAACCTGCTCAGAAT
GTGAACTACATGCCCTTAATGGAGGAACTAGGCCCAGGCAAAATGACGTGTATGTTTGAG
GCAAGCTAGGGCTGCGGCGTGGGACCTAGAGACCCGAAGGGTGCTGCTGTGTCTGAACAG
TACTAGTCAAGTCAGACTTGTATACTTGAGAATACCTCAGCAACTCTGACTAGTCATTGC
AGACACTGGTATTACAGCTGTTGCCTCTGAAAGAGATGTAGTCCTGACTAGCTACCTACC
TAACACTTAGGATTAGGTAGGATTAGGTTCAAAGCTTCCAGCAGGCATGTGTGATGACTC
AACTTTTTTCCCCATCAGATCGACCATGTTGATCACAGTCTTTTAAGCCAGTTTATCTGA
CATGCCTGCTTGACAGCGCCTGCTGCTGCTGTGCCCCTTGGTCCAGGTAGTTGATGTTAT
TTTCTGTATTTTTTTTACCTAAGGTTTGCTGACGGCCAAGACCAGGCTTTGAATGAATGG
TGAACTCAGAGGGGAGCGCGTTGGTAAGTGTCCCTCCTCCAGTGCAGACTTGTTTCTACT
TGACACAAATTGGGCTGGTGAAGCTGATGATACCACTTCTTTCCCCATCAGATCGACCCT
GTTGATCTCATATGCTAATAGCCAGTTTTCTCTGATGCACCAGCCCCTGGAATGACTCAT
CTTGGCTTTAATCTGTTTCATGTATTAATGGCTCCCATCTATTTTCTTTTCTACAGGCCT
GAGGAACCCACGGATGCCAGTGTTGGTCTATTCTTGCTTTCAGGTGCGAGTCTGTTTTGA
CCTGTTTCTAGGGATGTTAGCAACAAGTATGGAGGGTAATGGACCCAGTTCTGAAGCTGT
TCTTAGGGCTCTTGATACTCAAGTTTACCATGTTGCTCAGTGGGATTGGAGGGGAGGGGA
ATGTGTATGTTGCCAGGTCATCTACCTCATCTGATATTAGATCAAGGAGTGGGCCAGAGT
GAGTTTCAGGATGCTGCTCCTGTCAGGCAAGCCTATCAACAACTGTTTTTCTTTTTAGGT
ACCCCTTGGAACACAGAATAGCAGTCTAGTCCTGCTGCCACCCCCACAAGGCTGGGCATG
GTTCAAAGGCATGCAGGATGCAAAGAAGAGTCAGCTTTGGCTGGGGAGGAGTGGTTTGGT
GTACACTGCTACTGAAATAGAAACTTTTGGCCTTCTGTCTGTAGAAATAAAAATCTGACT
TGGTGATGTTTTTATATCTACTGCCCCTCAGTTTTTCTGGGTTAACCCTGGAGTGTACTG
GGTCTACTCCAAATGCCAGATTAGTGATTTTCCCCCAACAGTGTAAATGAGGCTGCTGTC
ATGCCCCTACCAGGAACAGTGCATAAGCCCAAGTCCTTGGGATTTATTGATAACAATTTC
CCAGTCCCTTGAGTTGGGGATGCCTGTGTCTACTTAGACACCTTTTTTGTGGCTGGTCTT
TTTTTTTCCCCCCCCCAGAGCTGGGGACCAAACCCAGGGCCTTGCACTTGCTAAATCCCC
AACCCCTCAGCTGATACTTTTAAGCAACACAGTATCTTATTTCCCCCATGGGTCTCTAAA
AAGCCCATTTAAAATGTGTATGGATGTTTTGTTTGTATGTCTGCACCACATGTATATAGT
GCCCACAGACATCAGAAGGGCATC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved