Rattus_norvegicus Locus Mono:67:SNORA71
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Mono:67:SNORA71
Rattus_norvegicus
Mono:67:SNORA71
8
SNORA71
1001..1134
2134
ACAAGCAGCTGCCAGCTAGGGAAGGCAGGGACCTAGTGCCCCCTGCTTATCTGTGATTC
TCTGAACTCTGAATGCACTTCATACTAAAATACTAAAAATAGATCATGATTTATTTCTTA
CAACACTGATCTAGCAAAGAAACATTCCCTGACTCTTTTCCACACGTCAGGGACAAAGAT
TGTTTTATCTCATTTAACAAGCAGGAGAACCAGGTAAGGCATGGTTTAGTACTTTCTGTC
CTTTGATGGCAAAATGAAAGTTCAGAGAGCTGACATGCTCTACTCAAGACTACAGGGTGA
ATAAGTGGCTGAGCCAGGAATTGAACCTGGGTCTTGAAAGTCCAGAGCAGAGATATTTAA
TATCAACTTTCTATCAGTCTGGAGTTGCTATGGAGTTGGAGTGCCACACCCAAGGTTTCA
TGTGCTGAAATTGGATGGCAATTGTGACCTCTTAAGTTGGAAAGTGGGGCTTGGAAAGAT
GTCCCAGTGGTTAAAAGGCACACACCGATCTTGCAAAAGACCGGGTTTAGTTCCTAGCAC
CAGCATGCAAGCTCACAATCATCTACACACACACACACACACACACACACTACACACACA
TTTTTTTTAATTTTCTAAAAGAAAGTGATTTTTACTATGGTATTTAAAAAGTGAGAGTCT
TTGAGAACCGGTTGGGATGGGACAAAGAAATGAGGATGGATCCCCATGACTGGATTCTGC
TTTCTTTATAAAATGAGGGACAGTGGTCAGAAAGGCAGACATGCACGTGGGCCCTCCCTG
TCTCTGACTGTGCAATGACCTTCTTACTCTCAGAACTATGATAGGGAAGTCATCACCGGA
TTCATCCTCTAAATCTTTCCCTTCCAGAATCAGGAACCAAAACAAATATATTTTTTTCTT
TATAAAGTATCTTGTCTCCATTATTTCATTGTGGAAACAAAAATGAAGCCATATAAGAGT
TAACACAGAGTTTTCACAATCACTTAAGAGTACAATAAAACCCATGACACCCAAAAGCGA
TCTTGGCTGCCTGTGTCCCAGTCACCGGCAATGCAGGGAAAGGATACAGAAAGACCTGTT
CCCCAAGTTTGAGGGCATCCATCCTGACTCCTCCAAAGTCTGGAACTTTTCTACACTCAC
GTTTTTCTCTGCCAACCTTAGAGCAGTAGTGTTTTCTGGAAGCCACAGAAATCAATGACA
GGCAGGAAATTTCTTTGTGAATAGGATTGCTGGTTGATCTCTGCCAGGTGCCCTCAGAAG
TCCTCAGGTTTCAAGAAGAGGCTGAAGAGGGCACTTGCAAGGTATCTGTGGACAGCAGAG
GACCACAGAGTGGACAGCAGAGGACCACAGGGTGGACAGCAAGACCACTACATGAGGTGA
AACTGGAGACATTGCCCCCTCAGAGCATCAAGGAATCATTTTTTTTACTCTGCTTAGCAA
TTACCTCAGTTATGGGAGATTTCAACATTCAACCTCAACACCAATACCTCAGATGGCTAT
GGCCTGTCCTTGTGTCCATCTGCTAGTGCCTGGAATGACTAAAATGACAAGAGATTTTCT
GTTTAACTTGTGGCTAACTTGTTTGCTACCTTCCCAACAACAGTGCAGTAAACCCCATGA
TGTGAAGAAAAGAACATGATAAACCCTACTGCCTCAGACATGCAGTGTAATCCCTCCCTC
TTCGAAGAACATATTTGAAGCTGAGACTCAATGACCACAGTCAAGTGGAAACATTACAGC
TGGCATCCAATTCTGAAGGTGAAGGGAGGAGCAGGAATGGAGCCACCAGATGAAACCAGA
GCTACAGGCAGGAGACATGTCTGGCAAGGACTGACAGTGAGTGAGATGTCTGAGCCTTGG
GTAGCATTGTGGGATGCTCTAGGACCCTTGGCTGAAAACTGGCAGCCCATGATAGTCCCA
TCCTCCAGCTTACCACTTTTATCTAACACCAGTTGTACCACAACCCCATGAATGGAAGGC
TTCCCCTCAGGTAATTTGGGTTTTAGTCCATGGAACTAGATACATGTTCTTGTTGATGTC
TCAGACACTGCCTAGTCCAGACATTTTCAAACAGTACTCCAAAAGTGCCTCGGTAGCCAT
GCTCAAATCATCCCAGGGTACTTCTGTCTCCTCAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved