Rattus_norvegicus Locus Mono:555:SNORA29
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Mono:555:SNORA29
Rattus_norvegicus
Mono:555:SNORA29
10
SNORA29
1001..1130
2130
GATCCCTCCCCCCAGTTTAGGTCTAGTCCTACTGAGAGGAAGTGGTATTTAAACAGAGA
AAATAGAGCAGGAAGCTGTGGCAGAGGCTGGCCTGGCGTGCCCACGTTCAAGCACTGTAA
AACCAACAAAGAAACACAAACACAAGTTGAAATTGCTTAGAACTAAGGTCTATGTATATG
CTGCTGTGTGCATTTGTGTGTGTGTGTGTGTGTGTGTGTGTATGTGAGTGTGTGAGTATA
AGTGTGTGTATGTGTGTGTATGTGGTATGTGGTATGTGTGTGAGTGTGTGTGAGTGAGTG
TGTATATGTGTGTATGAGTGTGTGTATGTGTGTGTATGTGGTATGTGTGTGTATGTGTGT
GAGTGTGTGTATGTGTGTATGTGTGTGTGAGTGTGTGTGTATGTGTGTGAGTGTGTGTAT
ATGTGTGTGAGTGTGTGTGTGTGAGTGTGAGTGTGTGTAAGTGTGTGTGTGAGTGTGTTG
CAGGTAAGACAGATTGTACTACAGAGAAGACAAGACATATTGGAAAGAGTGAAGGGTATT
CAGCATCTAGGGCCAGGCCAGTTGGTATTTGTTGAGTTTTGTCTTACACTTGACTCATCT
GAAAGATGACCGACCATGGAGGCACACAGCTGTAATGCCAGGACTGTGAAGAGAGAAGCA
GGAGGATTGTCACAGTTGGTCTCGTATCAAGTCCTTGCCTCAGACAAAAGTGTAAACCAA
ACTAAAATCTGAATAGCTGCCGTGGCTGGTGACTGCCATACTGGATGGTACAGGTTTAGA
GTGTGACAGGGGGAAGGTGGAGTGGCTGGGGCAGGCCTCTGGACTGCATGCGGTTGTTGT
GTGAAGTTTGAGTTTTATTTTTAGTGCTATGAAAAGTGGCTTGGAGCAGAGGAGTGGCGT
GACATACATTTNTTTATTTATTTATTTATTTATTTATTTATTTATCTATTGTTATTGAGT
TCTTCTTTGATTACTGATACTGGAGGGTCAAACACAAGGCCTTACACATGCCATTAAATC
CACCATTAAAGCTAAATGCTGTGCTTATGGGATAAATTAAAGGTGCCATGATCTGAAGGG
AGAGGGCTTTTCCGTGCCCTCCCTCTATATGAAATGGTTGGAGAGTGAAAAGAAAAAAAA
AGAAAGAAAAAAAAAGAAAAAAGAAAGCTAAACGCTGGCCCCTGGTTTATATTTTTAGCA
GACCACCTTAGTTGGTATAAGAATGGTGTGTGACGTATGAGTGTAGCAGCGCAGAAGCAG
GGCGACGGGTTTGGGAGAACATTCTCAGGGGAGAGAAATTAGTGCTTTGAACCAGACAGA
ATTTTGAATGTGGAGCAAGGGCAGAGGTCTTCCAGTGAGAAAGAGGGGGAGAACTGGTCC
TTGTTCTCCACGGCGGCACCAGGGCTGTACAATTTCAGCCATTCCTGTTGGCCACCGATC
CCCACCTGCTGGCTGTTTCTGGAAGTGCCCTTATAAATGGATACAGGAGCCTGGGGTCAG
GATGCTGAGTGAATCTTCCTTAGATGGAAATATGGCTGGATGGGTTGGGCTGCATTCTTT
GGGGCAAATGTTAGACCGAACCTCTTCTCCTCCTGGGGCTATCACACTCTTCTCTCTCTT
GATTATGGGTTAGACAGTGATGAACCACATGGCTGGGGGAGGGCACACGGCGTTAAGAAT
CAGGAGGGGTGGGTGTCAGTGTTGTAGGGCCATGCCAGTTTCCACCCAAGCCAAGGTCCC
AGCACCCTGGAATTGCCTCTGACTGCCCCAGGGGCTACGAGTATGGGTGGAAGTGCGCCG
CAGGAGAAGGGCGTGTCTCCCGAAAGCAGGGTGTGGCCACTGGTCCTGAAGATCAGCCGG
GTGGCCAGTCACTGGTCTTTGACAGGTCGGCGTTAAACCTGCTCTGTCCACTGTGTGAGA
CGAACAGGTGGAGGGTGGACGACGCAGAGAAAGCTCGGAGCGGGCCGCGGAGGTTCCCAC
AGCCCCATTACTGTCAGCGTTGAGCCGCACCCCTCCGGGCCGCACTTCCTCTCTCAGTCC
CCGCTGCCGGAGAGCCCCGCTAGGCTCGGTGATCCTAGCCTGCAGTTTGCCGCCGCTACA
CCTTGGCTTCAGCCTGCGGGGTAAGTCGAAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved