Rattus_norvegicus Locus Mono:161:SNORA8
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Mono:161:SNORA8
Rattus_norvegicus
Mono:161:SNORA8
5
SNORA8
1001..1140
2140
TTGTAAGCTTTGCTTTTATATTGCGGTTATTATTTTTTCGTTTCATTTCATTTCATTTT
TTAACAGAAACGAGAAACAAAAACCTGGCCATAGAAGACTGCCTAGTATACCAATATTGC
ATCTTAGTAACTTCCTTCAGCTCCCATCTTGCTTTAGCTAGACTTTAACCTTTTCTTCTT
ATTTGGTACTGTAAGGAATATGTTCCCTACTTTTGAGAAGAAAGCTGGAAGTTAGAATAC
TTTTCTCATTGTTCAGCCTAGAAATAGTGGGAGAGGGATTTGAACCAGATCTATTAAAGC
TTTTCACTTAGCAATCAGTTTTTATGTTGACTGGGGACATATTGTAATCAGGTAACAGGC
ATAGTGGCACAGGTCTAATTCTGTGTTCCTGAGGCTTGTATAGGGAGAGATTACAAGTTC
AAAGTCAGACCCTGTCTCAAAACAACAAAAAAAACAAATATAACTAGAAAATAATGTTTC
CATAAAAATCTTACTGTTTTGAAAGACTGTTGCTAATCTAATACTTAACAGTATCATTTT
TTTCTCTAAGCAATGCCGTGAACATTTTCTCTATATCTATGATTATGTTATTAATTAGGG
AACAGCAGAAAATTGTGTCCTAGGTTGACCTGGAATTTCCAGCAGTCCTCCTGCTTCACT
CTCCCCATTGTTGAGATTATAGGCGTGAGTCATCACACCTGGCTGCGCTTATGTTTTCCG
TGCTCTTTAGCTATCCCATGTTTTCCCACAATATTTACACCAAAACAATGAGTAACCTAC
ATTTATTATTAATGTAAAGTATTTTTTATATATTTTAAACACATTAGAAAAATGGCTTTC
TTTTTGCTGGGAGGGATTAAGACAGGGTTTTTGTGTATTTCTGGCTGTCCTGGAACTCAC
TATGTAGACCAGGATTGCCTTGAACTTGTAGAGAATTTGCTGAGATTAAAGGAAAGCAGC
ACCCCAGGCCTGGCTGTGATTTCTTTAAGAAGGATCTTTATTGTACTGTATGGGCATCTG
TGCTCGGCAGTTTCCTCTTGCTAGAATGTTTCAAGGACAGCCCTATAGAAATTCAATATC
TAGCATTGTTGATTTTCTTGACTTTGTGCTTATTAAACCTGGTATTTCTATGTATGCAGT
TTTAAAGAAAAAAATGTAAGAATTTTCTAGTATTATTACTGAACTAAAGGAAGTCTGAGT
TTATAAAATTTCTGTTTACCTTAACAAATAACCAGTGGTTTTCTAGAAAGCTTATAATTA
TTTATGATACATTGATACTTTTATTATAAAAGTTGAATATGATTAAAATGATTTACTACT
GTTTATAATGGTTTTATTGTGGAAATTTACAAATGAACATAGTAGCCTCACTCATTGGGG
GGTACTATTCAACATTCAATTTATCTTTCAACACAATTCAGTTCTGCTAACCCTTTTTTA
CTTTTCTTTTTTTCACCATTTGTTTTCATTGGACTAATAGTTTAAATCAAGTATCATTTT
ACACATTAGTTTTTCAGCTTATTTTGCCTTAACCATAGTACCATTTTCAACCCAACAAGC
ATGTTTACAAATATTATTTTAATAGTGTGTATATCCAGGGTATGTGTGCTAGTTCCTGTG
GAGACCAGAGGCGGTGGATCTGTCTAGAGCTTGGTTAGGGCCACCACTAAATGTGGTGCT
AGGAACTGAGCTGAGGTGCCTGGAAAACCAGCAGTAGGAACTCTTAACCCCAAGCAACCT
CTCCAGTCTCCAATCAAATAAAAACTTTAGAAAACCTTTGCGTGGTGGGGGTTTGTGCTG
GGGATCAAACGAAAAGATAATATGCATGCTGAGCAAGCATTCCATGGCGGAAAAACTTGC
AGCTTAAAAATCTTAATACCTAGTACCTAACTTAGTCTTAGATTACAATACTCCTTTAAA
AATTGGCTTTTATTAATTGCTTTTTATTTTATTTTATTTTATTTATTTGTGGTTTTCTTT
CTTTGAATCATTTTATTTGTTTTATGTATACTTATATCCAGGGACATCAGATCCCATTAC
AGATGGTTGTGAGCCACCATGTGGTTGCTGGGAATTGAACTCGGGACATTTGGAAGAGCA
GACAGGGCTCTTAAGCACAGAGCCATATCTCCAGCCCCTTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved