Rattus_norvegicus Locus Mono:392:SNORA19
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Mono:392:SNORA19
Rattus_norvegicus
Mono:392:SNORA19
18
SNORA19
1001..1141
2141
AAAAGGTTAAATGTAGAGACAAATTTGGAACCAGTTATTCACTGTTCTTTTGTAGAACA
ATGAAGGAAATATTGAACAGTGATGTGTTGTCATCTGATGTCTTGTTTAACAAGTTGTGA
ATCACTATTAGTAATTATCAGAGTAATTATTTTTACTAATTGCTGAAATTCGTATAATTG
AATATGAATTGAATATATCTTACTGTGGTGTCCAAGGATTGCTTTTCCCCTAAATGTTAT
TTTGTGCTTAAAGGTATTCATTTAAATAAACTTCCTTCAACATAATCTAATTTTATTTAA
CATTTTTCGGGGTATACATACTTTTAATGCTTTAAATATTGTTGAGTACCCTCTGTTCTG
TATGACAAAAAGTCTCATTGGTTTTCCTATGTTATGGTCCTAATGTCTCAGATTATAGTT
TTAGTAATCTTTGGCCACAGTGTGAAATCCAGGAAAATTTAAGTTCTCTAGAGTAGACTT
ATTATGAATGGAAAAGACTGAGTAGTGTGCTTGGCACTAACAGAAAATTAATGTTGGTTC
TAGGATATTTATGGAACAAATGCACCTCTTCTCCAATAACATTCGGATCTAAATGATCTC
TTAAATCATATCACCCCAGCCCTTTGACTAAGGTCAACTGTCTAAATCATCTCTATTATC
TTTTGACTCGGCTTAGTAACATTTCAGAAAAACGTTGTTTTATGGATTTATTAAATTCAT
TAACAGCAAGTGAGAAATGCCAGGTATTGTGGAAACATATAACCAAAGATGACCTGTGTG
AGAAAGTTTCAGAAAGACTTTAAAAAGAAACAGTGATACTGAGAAGAAGCCATATGGATC
AGTGCTTTCAAAATTAAGACAGAGAGAAAAGTATTCCAATCAGAAAGAACTATATCAGAA
CCCTGGTTTAAAAGAGAAATCAACACTTCCATAGATTTTTTTTTAATCATTAAATAAAAT
CTTCCAAAAACAGTTCATGGGAGTAGCTAAAATCAGTACCAGAGCATACATAAATGACTT
TTAAGAACCAATGAGGTTTGACTGTGTGAGCAGTGTTATTTCTTATGTGCTATACTAATA
GTTGAAGGTTCATTAGCAGAGTAACTGCATATAGTAATTCTGCCAGTCCCCTTCAGACAA
AAATAAAAAAATTAAAAATTAAAAAATTAAAAAATAATAAAGAACCAATGAGGAATAAAT
AAATATGACAAAATAATTTAAATATGTCATAGCTCCAATTGTGTTCTATTGCTAGCATAT
GTTTTATACTTTATATTTGGAACTTTTTAATTGCTGTGATAAATTATCATGACTAAGGAA
ACTTGTGGAAAAGTTTGTAGGAGGACTACAGTTCAGAGGGTGAGTCCAGTCAATAACTAC
CATGGTGGGGAATGTGGCACTATGCTGATAGACATAATATGCTGCTGGAACAGAAAATAA
GAGTTTATATATTATTTACAGAGGGGAGAGAGAGAGCGAGAGAGCGAGAGAGCGAGAGAG
CGAGAGAGAGAGAGAGAGAGAGAGAGAGAACTGTAAGCAAGTGCTCAACTAAATGCTTTC
ATCGATTAAACATCGCCATGATTATAATGTCTCATCACAGGAATAGAAAACTGATTAAAA
CAGACATATTGACTCAATGTGCTATATATTATATCAAGAATAATTGGAATTGGAGAAATG
GTTCAGATGAGTCTTTCATAGGATCAGAGTTCAAATCCCAGTACTGACATTTAGGCATTA
ACAACCACCTGAAAGTCTAATGCCAGGAGATGGGAAACCCTCTTATGAACTCTGTAGTCC
CCCGCACGCACACTTGAGATAGGTATGTTATGATCCCCAAAGGAAAGCCTAATATTATTC
TGCTAAATGAACATAGCAATGAAATGATTCCTAAAGATACAACAGTATATTCATATCATG
ACTGATAAGTACATCAGTCTTCCTTCATCAAATATTCTTTGAATAGAATAATTAACATAG
AGTTCTGCAAGTATACAATATAGAATAAGAGATTTGAGAGTGTCCATCCTAAAATGGGTG
TATTAATCATACTCCTCCAGAGGCTTAGGGATCTATGTGGATGAAGAGGGAGAAAATTTA
TACAGAGCAATAGATGATAGAAGACTCTGAGGAAACAGTGGC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved