Rattus_norvegicus Locus Mono:8:SNORA70
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Mono:8:SNORA70
Rattus_norvegicus
Mono:8:SNORA70
X
SNORA70
1001..1117
2117
TGTCTTCAGACACGTCAGAAGAGGGCATCAGATCCCATTACAGATGGTTGTGAGCCACC
ATGTAGTTGCTGGGAGTTGAACTCAGGACCTCTAGAAGAGCAGTCAGTGCTCTTAACCGC
TGAGCCATCTCTCCAGCCCGTAAGATTTTTTTTTTAATTCCTTTTAAAACATTTCTTCTT
GAGAAGTTTATATAATTGGACAATTTTTATATTTATGCTTTGAAGCATTCTAACTGAATG
TTCGACAGGTAAAATCCTTAAGTCAGGCATAGCGGTGTCTATAATCCCACCCCAGGAGGA
TAAGGCAAGAGGAACACAAGTTTGAGGTCAGCCTTGGTTCATAGCAGTATCCTGTCTCAA
AAATAACATAGAAGGGGTGGGTAAGAGCACTCTTTGCTCTTGCAAAGGTCCTGAATTCAG
CTCTCAGAACCCACATGGTGGCTCACTAGCATTTTTAACTCCGGTTCCAAGAGATCTGTC
TTCTGGCCTCAGTGGACATCAGGCAAAGGTGGCATACCTACATATATGCAGGCAAAACAC
TCTTACACATAAAATAAGATTAATAAGAAAAATGAAAAAGAACATCTCTCTTCCTTAAAA
TATTAGAATACAATGTGGGTTGGGGGCAGAGAAGGAGTTGAGACTATGTCTCATTACATA
GCTCTGGCTGTCCTAGAACTCGTATTTAAATGAGGGTGGCCTTCAACTCATAGAGATCTA
CCTGTCCTCTGCCTCCCCAATGCTGGGATTAAAGGTGTGCACCACCATACCTCTCCCATA
CCTCTGTAGAACAGTTTTCTCCGATGTATTTATTTTTATTTATATGAGTACAGTGTAGCT
GTCTTCAGACACACCAGAAGAGGGCATCAGATCCCATTGTGAGCCACCATGTGGTTGCTG
GGATTTGAACTCAAGACTTCTGGAAGAGCAGTTAGTGCTCTTAATGGCTGAGCCATCTCT
CCAGAACTCTAGAACAGTTTTTTGAAGAATATGTTTAAAACTTCCAGTGGCAAAAGAAAC
CTGGGTTTTTGTGTGCAGAGGCTGCAAATGCAGTGTCCTTGGGAGTGCGTGCAGCCTGTT
GCCTATATGAGTTACCCTAAGGGACCTTGGAGACAATTTTCCAGTGGATATTCATGTTTC
TCATTTTAATGGCTGCCCCCAATCTAGCCTCCAGGTGGGTATGTGGGTAACTTTGGGAAG
GCCCAGGACACAGCAGCCAGGGTTCCCATTGGCCAAGTCATCACGTCCATCTGCACCAAG
CTGCAGAATAAGGAACCTGAGATGGAGCCCCTGAATAGAGCCAAGTTCAACTTGTTGCTA
GAAGAGCCACACCTTGAATACGTGGGGTCTCTAAATTGAATGCAGCTGAGTTTGAAGACG
CGGTGGCTGAGAAGTGGCTCATTCCCGAAGGCTATGTAGTCAAGTATACCCCTAATCATG
GTCCCCTGGACAAGTGGAGAGTCCGCACTCAGCTCCTGAGAGTTTCCACTGGGCTCTCCC
ACAACTCACAGAATCATGCTTGGAGATAAATCTCACATCCAGTTTGAAAAAAAAAAAAAA
GCTGGCTGGCCGTAGTGCACACCTTTAATTCCAGCACACACGGGGAGGCAGAAGCAAGCA
GAAGTCTATGAGTTTGAGGAGAGGGCAGCCTGATCTACATAGAGAGTGAGTTCCAGGATA
GCCAAGACTACAGAGAAAAACTTTATCTCAAACAAAACATAAAAAAACAAAACAACCCAC
TGTTTATTAATTCATTTTTATCCTTACACTAGAATTCTGAGGAGGGTTTATTATCTTAGC
CTATAGATAAGAAAGCCAAGGTACAGTAACGTGGGGTCACCTGCTCTGAGGTTATCCAGT
TTATCAAACCCATGATTTGAATATGCTTCCCCTGTCAGCAATACCCAGATCAAGAGCGAC
AGACTGAGCCAGAAAGGCAATGCATTCGTGTAGCCCCAGCTGTTCAGGAGGCTGAGGATC
ATGTGAGGTCAAGAGAATGAGTCTAGCCTGGGCAACATAATCAAGACTTCATCTTAAAAA
TAACTAAGGGGAGGGGGCTGGAGGGATGGCTCAGTGGTTAAGAGCACCCGACTGCTCTTC
CAGAGGTCATGAGTTCAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved