Rattus_norvegicus Locus Poly:13:SNORD115
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Poly:13:SNORD115
Rattus_norvegicus
Poly:13:SNORD115
1
SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115
1001..1070, 3733..3811, 7268..7345, 11037..11114, 11608..11685, 14782..14859, 16583..16659, 18388..18466, 21142..21220, 23001..23078
24078
TTTTCCACGAAATATCAGGCACAGGGAACCTAGCCAGTACGGGAGCTTGAAGTTGAAGG
GGTGGCTTTGGCTACCAATTCCCTTCAATGTGTCCTCACACTGCTTCATCCTTGATCTTA
CTAAAGTTTACTTCAGTATTCATCAGAAAACAAATGCTATCAAGAAGATGGTTTCTGGAG
CTCTTGGGACAGAGGAACGTGATGTCAATGGGATACTTGCAAACACCAACTGATCTAGTC
ACACGAATTTTGGTCACATTCTCAGTTTGATCACATGGCAATCACTGAGTGCTAACACTC
AGGGATTCATGGCCAACATAATTGTAGCTTTCTTCTGGGCAACTGATTCTCTCCAGCATT
CACTTACCAGCTGTGGGAACTGATTGTTACCATGCAGTATGGAAATGGGGAGCAATGAAC
ATAGCCTAGCACATAAAATTTGAAAGGCACAAGTCTCTTGACAATTTGTTTAAAGTATAT
GTAACTGTTCGTGTATTGTCCTTCCCATATTACTCAGGGCACTTCACCTTTTCTTGGTTT
CTGACAATGTTTGGCAATTGAAAGTTTTGATCAGTGTAACTGATCAAGAGTATGTGTCAT
CCCCCTCCTCAATGGTTTGGTTTCCGGTACCTACTTACCTTAATTATGTCTTAGGGAAGT
AACTTTCCATGTGTTGGGAATGTCAGCATGGAAGTGGATGTTGCAAGAGTGATTCTGCTA
AGTGGCATCATACATTAGACTTCTTAAACAGCCTCCTTAAAATTAACATGATTGTATGAA
CTGAAGCAATAGAATTGGTCTCACATCATGCTCTTTCCTTTTAGAGAGGACAGTCTTCAA
ATTCCATCTAGGTCTCCCCTTATTCCACACAAGAGCGCTGTGCCCTTTTATCCTCTACAC
TTGCAAGAGAGGATACAAATTCTGAGGAAGTGCTGCCAGCCCAGGTAAGCCATGGTGCTT
GTGAAATTAAATTAGTGACAGTTGTGTCCTGCCTCTGTCTGGGTCAATGATGACAATGGA
AAGTCATGAACAGGATGATGACATAAAAATCATGCTCAAAAGTAAAAGATCTGTACAATA
AGAACTTCAAGACACTGAAGAAAGAAATTGAAGAAGACCTCAGAAGATGGAAAGATCTCT
CATGCTCATGGATTGTCAGGATTAATATAGTAAAAATGGCCATTTTACCAAAAGCGATCC
ACAGATTCAATGCAATCCCCATCAAAACACCAATCCAATTCTTCAAAGAGTTAGACAGAA
CAATTTGCAAATTCATCTGGAATAACAAAAAACCCAGGATAGCTAAAACTATCCTCAACA
ATAAAAAAACTTCAGGGGGAATCACTATCCCTGAACTCAAACAGTATTACAGAGCAATAG
TGATAAAAACTGCATGGTATTGGTACAGAGACAGACAGATAGACCAATGGAATAGAATTG
AAGACCCAGAAATGAACCCACACACCTATGGTCACTTGATTTTTGACAAAGGAGCCAAAA
CCATCCAATGGAAAAAAGATCGCATTTTCAGCAAATGGTGCTGGTTCAACTGGAGGTCAA
CATGTAGAAGAATGCAGGCTTTGAACTCAAGCGATTTGGATTTGCCTGACCCTGCCCCAC
CAGTGCTGGGATTAAAGGAGTGCACCATGACTGTCCAGCTGGATAAGTGTTTTGATGTAT
AAAGACGTATGGAAAACTTAAAAAATTCAGAGAAGGAAGAAGAGGAAAATAGAACTTCCT
CATTGCAAGAAGTTATGCATAGATTTGGGGTAGAAATAAAAATAGGTACTTATAGATCTA
TAAAAATCGGTGTCAAAGCACAATTTTATATGGTACTTTTTCTGAATCTCCTGATATGAT
CAAATGCTTTTTCCCCCTAGTCTGCTGGCATGAAGGATGTTCATGCATAGCTAGAATAAA
TCTTGTGGGATGGTGAAAAAAAATCATGCTCAATAGGATTACACTGAGGCCCAACCAGGG
AGCCAGGGTTACAAGCAGTGATTTGTCTCTTTGAGGACCACTTTTAGGACACATCTGAGC
TGCTCTGATGCCTTTGTGCTCTTTCCCCTCTGTGGGAACCTGGACAATCTTAGTGCAAGT
GTGCTGGCAAACACTGCCTGCCAACTAGCACCTAGTCTCATAATCTGCTTGTGTGCAAGT
CTGCAACACCAACCCCGTCATCATTACCCTCTCTGCTCTGATGTCTTGCAGTCACCTGGC
ATCACCCCTGCGGTCCAGTGGATCACTATTCCCAGATGAGTGAAATGCTCATGAATAATG
GATTGAACTTCTTATAAGATATTCCTTATTATTTTGACCAATAATTTCAGCCCATCAAAG
GTTTCTTAATTAAAAATAATGCAATACCAGTCAGAAATGAATTTCACCTCTCAGTATGTT
CTCTCCCTTTGAACTGCACAATTAAAAATGTAGAAAAATTCCTTTCTACCTGTAGTTCAT
ACACATATAAAATTGAATTTCTTGGAAGAGATCCTAGATGTTACTATCTACACAAAAGGA
GGGATCTAGAATATGAATATACCTTTTGAATTTGGAGAAATTACAGTCCACACACAGGCT
CACAAATCCAAGCTGGTGCACAGCTATCGATTTTCAATGACAAGGGGAACCCTGGAATAA
GACTTTAGTTTAGAGATGTAGAAATTGGCGATTAATTTCATGAATCAAAAGACAACCCCA
AGAAATATTCCCCCATAGAGAGCTTGCCGAAATTTTTCACAAAACTCTCAGGCCACAGGG
AACCTAGCCAGTACGGGGGCTTGAAGTTGAAGGTGTGGCTTTGGCTACCAATTCCCTTCA
ATGTGTCCTCACACTGCTTCATCCTTGATCTTACTAAAGTTTACTTCAGTATTCATCAGA
AAACAAATGCTATCAAGGAGATGGTTTCTGGAGCTCTTGGGACAGAGGATCGTAATGGCA
ATGGAATACTTGCAAACACCAACTGATGTAGTCACAGGAATTTTGTTCACATTCTCAGTT
TGATCATATGGCAATCACTAAGTGCTAACACTCAGGGATTCATGGCCAAAATACTTGTTG
CTTTCTTCTGGGCAACTGATTCACTTCAGCATTCACTTACCAGCTGTGGGAACTGATTGT
TACCATGCAGTATGGAAATGGGGAGCAATGAACATAGCCTAGCACATAAAATTTGAAATT
CACAAGTCTCTTGAGAATTTGATTAAAGTATATGTAACTGTTCGTGTATTGTCCTCCCCA
TATTACTCAGGGAACTTCACCTTTGCCTTGTTTTCTGACAATGTTTAGCAATTGAAAGAT
TTGATCGGTGTATATGGCAAAGAGCATGTGTCATCCCCTTCATCAATGATTTGGTTTTGG
GTACCTATTGACCTATTGATCGCTTAGGGAAGTAACTTTCCATGTGTTGGGAATGTCAGC
ATGGAAGTGGATGTTGCAAGAGTGATTCTGCTAAGTGGCATCATACATTAGACTTCTTAA
ACAGCCTCCTTAAAATTAACATGATTGTATGAACTGAAGGGATACAATTGCCCTCACTTC
TTGCTCTTTCCTTTTTAGAGAGGACAGTCTTAAATTCAAGCTAGGTCTCCCCTTATTCCA
GACAAGAGCGCTATGCCCTTGTATCCTCTGCACTTGCAAGTGAGGATTCAAATTCTGAGG
CAGTGTTGGCAGCCCAGGTAAGCCATGGTGCAGGTGAAATTAAATTAGTGACAGTTGTCT
CCTGCCTGTGTCTGGGTCAATGATGACAACAGAAAGTCTAGAACAGGATGATGACATAAA
AATCATGCTGAATTGATCCATGCTTATCACCCTGTACAAAGCTTAAGTCCAAGTGGATCA
AGGACCTCCACATCAAATCTGATACACTCAAACTAATAGAAGAAAAACTAGGGAAGCATC
TGGAACACATGGGCACTGGAAAAAATTTCCTGAACAAAACACCAATGGCTTATGCTCTAA
GATCAAGAATCGACAAATGGGATCTCATAAAACAGCAAAGCTTCTGTAAGGCAAACTACA
CTGTGGTTAGGACAAATCTGCAACCAACAGATTGGGAAAAGATCTGTACCAATCCTACAA
CAGATAGAGGTCTTATATCCAAAATATACAAAGAACTCAAGAAGTTACACCGCAGGGAAA
CAAATAACCCTATTAAAAAATGGGGTTCAGAGCTAAACAAAGAATTTACAGCTGAGGAAT
GCCGAATGGCTGAGAAACACCTAAAGAAATGTTCAACATCTTTAGTCATAAGGGAAATGC
AAATCAAAACAACCCTGAGATTTCACCTCACACCAGTGAGAATGGCTAAGATCAAAAACT
CAGGTGACAGCAGATGCTGACAAGGATGTGGAGAAAGAGGAACACTCCTCCATAGTTGGT
GGGATTGCAGACTGGTACACCATTCTGGAAATCAGTCTGGAGGTTCCTCAGAAAATTGGA
CATTGAACTACCTGAGGACCCAGCTATACCTCTCTTAGGTATATACCCAAAAGTTGCCCC
AACATATAACAAAGACACTTGCTCCACTATGTTCATAGCAGCCTTATTTATAATAGCCAG
AAGCTGGAAAGAACCCAGATGCCCTTCAACAGAGGAATGGATACAGAAAATGTGGTACAT
CAACACAATGGAATATTACTCAGCTATCAAAAACAATGGCTTTATGAAATTCGTAGGCAA
ATGGTTGGAACTGGAAAATATCATCCTGAGTGAGCTAACCCAATCACAAAAAGACATACA
TGGTATGCACTCACTGATAAGTGGCTATTAGCCCAAATGCTTGAATTACCCTAGATGCCT
AGAAAAAATGAAACTCAAGACGGATGATCAAAATGTGAATGCTTCACTCCTTCTCTAAAA
GGGGAACAAGAATTCCCTTGGCAGGGAAGAGAGAGGCAAAGATTAAAACAGAAACTGAAG
GAACTCCCACTCAGAGCCTGCCCCACATGTGGCCCATACATATACAGCCACCCAATTAGA
CAAGATGGATGAGGCAAAGAAGTGCAGACCGACAGGAGCCGGATGTAGATAGCTCCTGAG
AGACACAGCCAGAATATAGAAAATACAGAGGCGAATGCCAGCAGCAAAGCACTGAACTGA
GAATAGAACCCCCGTTGAAGGTATCAGAGAAAGAACTGGAAGAGCTTGAAGGGGCTCAAG
ACCCCATATGTACAACAATGCCAAGCAACCAGAGCTTCCAGGGACTAAGCCACTACCTAA
ATACTATACATGGACTGACCCTGGACTCTGACCTCATAGGTAGCAATGAATATCCTAGTA
AGAGCACCAGTGGAAGGGGAAGCCCTGGGTCCTGCTAAGACTGAACCCCCAGTGAACTAG
ACTGTTGGGGGGAGGGCGGCAATGGGGGGAGGGTTGGGAGGGGAACACCCATAAGGAAGG
GGAGGGGGGAGGGGGATGTTTGCCCGGAAACCAAAGAACAATTATTAAGTATTAAATAAA
TTAAACAAAAGAGTAAAAAAAAATCATGCTCAATAGGATTACGCTGAGGCCCAACCAGGG
AGCCAGGGTACAATCACTACTTTGTCTCTTTGAGGACCACTTGCGGGACTCATCTGAGCT
GCTCTGTTGCCCTTCTGCTCTTTCCCCTCTGTTGAAACCTGGACAATCTTAGTGCAAGTG
TGCTGGCAAACACTGCCTGCCAACTAGCACCCAGTCTCATAATCTGCTTGTGTGCAAGTC
TGCAACACCAACCCCTTCATCATTACCCTCTCTGCTCTGATGTCTTGCAGTCACCTGGCA
TCACCCCTGTGATCCAGTCGATCACTCTTCCCAGGTGAGTGAAATGATCACGATTAATGG
ATTGAACTTCTATAAGATATTCCTCAGTATTTGGACCAATAATTTCAGCCCATCAAAGGT
TTCTTAATTAAAAATAATGCAATACCAGTCCAAAATGAATTTCACTTCTCAGTATGTTCT
GTCCCTTTGAACTGCACAATTAAAAATGTAGAGAAATTCCTTTCTACCTGTAGTTCATAC
AGCCATAAAATTGAATTTCCTGGAAGAGATCCTAGATGATACTATCTACACAAAATGAGG
GATCTGGAATATGAATAAACCTTTTGGATTTGGAGAAATTTCACTCCACAAACAGGCTCA
CAAATCCAAGCTGGTGCACAGAGATCGATTTCCAATGGCAAGCAGAACCCAGGAATAAAA
CGTTAGTTTAGAGATGTAGAAATTGGTGATAAATTTTCTGCATCAAAAGACACTCCAAGA
ATTATTCCCCCAAAGAGAGCTTGGAGAAATTTTTCACGAAAGTATCAGGCACAGGGAACC
TAGCCAGTATGGGAGCTTGAAGTTGAAGGTGTGGCTTTGGCTACCAATTCCCTTCAATGT
GTCCTCACACTGCTTCATCCTTGATCTTACTAAAGTTTACTTCAGTATTCATCAGAAAAC
AAATGCTATCAAGGAGATGGTTTCTGGAGCTCTTGTGACAGAGGAACATGATGTCAATGG
GATACTTGCAAACACCAACTGATCTAGTCACACGAATTTTGTTCACATTCTCAGTTTGAT
CACATGGCAATCACTGAGTGCTAACGCTCAGGGATTCATGGCCAAAATACTTGTCACTTT
CTTCTGGGCAACTGATTCTCTTCAGCATTCACTTACCAGCTGTGGGAACTGATTGTTACC
ATGCAGTATGGAAATGGGGAGGAATGAACACAGCCTAGCACAAAAAATTTGAAACGCACA
AGTCTCTTGAAAATTTTATTCAAGTATATGTAACTGTTTGTGTATTGTCATTCCAATATT
ACTCAGGGAACTTCACATTTGCCTTGGTTTCTGACAATGTTTAGCAATTGAAAGATTTGA
TAGGTGTAACTGATCAAGAGCATGTGTGATCCCTTTCTTCAATGATTTGGTTTTGGGTAC
CTATTGACCTAAAGATCTCTTAGGGAAGTAACTTTCCATGTGTTGGGAATGTCAGCATGG
AAGTGGATGTTGCAAGAGGGATTCTGCTAAGTGGCATCATACATTAGACTCTTATACAGT
CTCCTTAAAATTAACATGATTGTGTGAACTGATGGGATACAATTGCCCTCACCTCATGCT
CTTTCCTTTTTAAAGAGGACAGTCTTCAGTTCAAGCTAGGTCTACCCTTATTTTATACAA
GAGCGCTGTTGCCTTGTATACTCTGCACTTGCAAGTGAGGATTCAAATTCTGAGGCAGTG
TTGGCAGCCCATGTAAGCCATGGTGCTGGTGAAATTAAATTAGTGACAGTTGTGTCCTGC
CTGTGTCTGGGTCAATGATGACAACAGAAAGACAAGAACAGGATGATGACATAAAAATCA
TGCTCAATAGGATTATGCTGAGGTCCAACCAGGAAGCCAGGTTTACAAGCAGTCCTTTGT
CTCTTTGAGGACCACTTGCGGGACTCATCTGAGCTGCTCTGATTCCCTTGTGCTCTTTCC
CCTCTGTGGGAACCTGGACAATCTTAGTGCAAGTGTGCTGGCAAACATTGCCTGCCATCT
AGCACCTAATCTCATAATCTGCTTGTGTTCAAGTCTGCAACACCAACCCCTTCATCATTA
CCCTCTCTTCTCTGATGTCTTGCAGTCTTCTGGCATCACCCCTGCGGTCCAGTGGATCAC
TATTCCCAGGTGAGTGAAATGATCATGAATAATGGATTGAACTTCTTATAAGATATTGCT
CAGCATTTTGACCATTAATTTCAGCCCATCAATGGTTTCTGAAATAAAATTAATGGGATA
GATATCAGAAATGTATTGCAATTTTCAACATGTTCTGTCCCTTTCAACTGCACAATTAAA
ATGTAGAGAAAGGGCACTCCTGAGGATGCAGAGCGGAAGAGACCACCAACACTCCTCACC
CCTGCCCACATCCCTGGCCCAAGAGGAAACTGTATAAGGCCTCTGGGCTCCCGTGGGGGA
GGGCCCAGGAGCGGCAGGACCCCTGCCTGAGACACAGCCGGAACCTGAAAGGAACAGACC
GGATAAACAGTTCTCTGCACCCAAATCCCGTGGGAGGGAGAGCTAAACCTTCATAGAGGC
AGACAAGCCTGGGAAACCAGAAGAGACTGCTCCCTGCACACACATCTCGGACGCCAGAGG
AAAAAGCCAAAGACCATCTGGAACCCTGGTGCACTGAAGCTCCCGGAAGGGGCGGCACAG
GTCTTCCTGGTTGCTGCCGCTGCAGAGAGCCCCTGGGCAGCACCCCACGAGCGAACCTGA
GCCTCGGGACCACAGGTAAGACCAAATTTTCTGCTGCAAGAACGCTGCCTGGTGAACTCA
AGACACAGGCCCACAGGAACAGCTGAAGACCTGTAGAGAGGAAAAACTACACGCCCGAAA
GCAGAAGACTCTGTCCCCATAACTGACTGAAAGAGAGGAAAACAGGTCTACAGCACTCCT
GACACACAGTCTTATAGGACAGTCTAGCCACTGTCAGAAATAGCAGAACAAAGTAACACT
AGAGATAATCTGATGGCGAGAGGCAAGCACAGGAACACAAGCAACAGAAACCAAGACTAC
ATGGCATCATCGGAGCCCAATTCTCCCACCAAAGGAAACACGGAATATCCAAACACACCA
GAAAAGCAAGATCTAGTTTAAAAATCATATTTGATCATGATGCTGGAGGACTTCAAGAAA
GACATGAAGAACTCCCTTAGAGAACAAGTAGAAGCCTACAGAGAGGAATCGCAAAAATGC
CTGAAAGAATCGCAAAAATCCCTGAAAGAATTCCAGGAAAACATAAATAAACAAGTAGAA
GCCCATAGAGAGGAGACACAAAAATCCCTGAAAGAATTCCAGGAAAACACAATCAAACAG
TTGAAGGAATTAAAAATGGAAATAGAAGCAATCAAGAAAGAACACATGGAAACAACCCTG
GATATAGAAAACCAAAAGAAGAAACAAGGAGCTGTAGATACAAGCTTCACCAACAGAATA
CAAGAGATGGAAGAGAGAATCTCAGGAGCAGAAGATTCCATAGAAATCATTGACTCAACT
GTCAAAGATAATGTAAAGCAGAAAAAGCTACTGGTCCAAAACATACAGGAAATCCAGGAC
TCAATGAGAAGATCAAACCTAAGGATAATAGGTATAGAAGAGAGTGAAAACTCCCAGCTC
AAAGGACCAGTAAATATCTTCAACAAAATCATAGAAGAAAACTTCCCTAACCTAAAAAAA
GAGATACCCATAGACATACAAGAAGCCTACAGAACTCCAAATAGATTGGACCAGAAAAGA
AACACCTCCCGTCACATAATTGTCAAAACACCAAACGCACAAAATAAAGAAAGAATATTA
AAAGCAGTAAGGGAAAAAGGTCAAGTAACATATAAAGGGAGACCTATCAGAATCACACCA
GACTTTTCGCCAGAAACTATGAAGGCCAGAAGATCCTGGACTGATGTCATACAGACCCTA
AGAGAACACAAATGCCAGCCCAGGTTACTGTATCCAGCAAAACTCTCAATTAACATTGAT
GGAGAAGCCAAGATATTCCATGACAAAACCAAAATTACACAATATCTTTCTACAAATCCA
GCACTACAAAGGATAATAAATGGTAAAGCCCAACATAAGGAGGCAAGCTATACCCTAGAA
GAAGCAAGAAACTAATCGTCTTGGCAACAAAACAAAGAGAATGAAAGCACACAAACATAA
CCTCACATCCAAATGTTTCCCCGGAAACCGGGAAAGGGAATAACACTCGAAATGTATATA
AGAAATACTCAAGTTAATAAAAAAAAATGTAGAGAAATTCTTTTCTACCTGTAGTTCATA
CAGCCATAAAATTGAATTCCTTGGGAGAGATCCTAGATAATACTATCTACACAAAATGAG
GGATCTCGAATATGAATATTTACCTGTTTAATTTGGATAAATTTCAGTTGACACACGGGC
TCACAAATCCAAGCTGGTCCACAGGGATCGATTTTCAATGACAAGGGGATCCCAGGAGTA
AGACTTTAGTTTAGAGATGTATAAATTGGCGATAAAATTTCTGCATCAAAAGACACTCCA
AGTATTATTCCCACAAAGAGAGCTTGGCGAAATTTTTCACGTAACTCTCAGGCCACAGGG
AACCTAGACAGTACGGGAGCTTGAAGTTGAAGGAGTGGCTTTGGCTACCAATTCCCTTCA
ATGTGTCCTCACACTGCTTCATCCTTGATCTTACTAAAGTTTACTTCAGTATTCATCAGA
AAACAAATGCTATCAGGAGATGCTTTCTGGAGCAGTTGGAACAGAGGAACGTGATGTCAA
TGGGATACTTGCAAACACCAACTGATCTAGTCACAGGAATTTTGGTCACGTTCTCCGTTT
TTTCACATGACAATCACTGAGTGCTACCACTCAAGGATTCTCGCTTTCTTCTGGGCAACT
GATTCTCTTCAGCATTCACTTACCAGCTGTGGGAACTGATTGTTACCATGCAGTATGGAA
ATGGGGAGGAATGAACATAGCCTAGCACATAAAATTTGAAACGCACAAGTCTCATGAAAA
TTTGATTAAAGTATATGTAACTGTTTGTGTATTGTCCTCCCAATATTACTCAGGGAACTT
CACCTTTGTGTTGGTTTCTGACAATGTTTAGCAATTGAAAGATTTGTTCGGTGTAACTGA
TCAAGAGCATGTGTGATCCCCTTCCTCAATGGTTTGGTTTTGGGTACCTATTGACCTATT
GATCTCTTAGGGAAGTAACTTTCCAGGGTGTTGGGAATGTCAGCATGGAAATGGGACTGA
AGAAGTGATTCTACTCAGTGGCATCATACATTAGACTTCTTAAACAGTCTCCTTAAAATT
AACATGATTGTATGAACTGAAGGGATACAATTGCCCTCACATCTTGCTCTTTCTGTTTTA
GAGAGGACAGTCTTCAAATTCAAGCTAGGTCTCCCCTTATTCCACACAAGAGCGCTGTGC
CCTTGTATCCTCTGCACTTGCAAGTGAGGATTCAAGTTCTGAGGCACTGTTGGCAGCCCA
GGTAAGCCATGGTGCAGGTGAAATTAAATTAGTGACAGTTGTGTCCTGCCTGTGTCTGGG
TCAATGATGACAACAGAAAGTCAAGAACAGGATGATGACATAAAAATCATGCTCAATAGG
ATTACGCTGAGTCCCAACCAGGGAGCCAGGGTTACAAGCAGTCCTTTGCCTCTTCGAGGA
CCACTTTTGGGACTCATCTGAGCTGCTCTGATGTCCTTGTGCTCTTTCCCATCTGTGGGA
ACCTGGACAATCTTAGTGCATGTGTGCTGGCAAACACTGCCTGACAACTATCACCTAGTC
TCATAATATGCTTGTGTGCAAGTCTGCAACACCAACCCTGTCATCATTACCCTCTCTTCT
CTGATGTCTTGTAGTCATCTGGCATCACCCCTGCGGTCCAGTGGATCACTAATCCTAGGT
GAGTGAAATGATCAGGCATAATGGATTGAACAGAAGTCAGTCCTCAAAAATTCAAGCAGG
GTTCCCCTGATTCCATACTACAGCTCTCACCCCTGTAACCCTCCGCATTTGCAACTGAAG
ATTCAAATTCTGAGCCAATTTTGGCAGCCCAGGTAAGCCATGGTGCTGGTGACATTGAAT
CAGTGGCAGCTCTGTCCTGCCTGGGTGTCAGTTAATGATGACAACAGAAAGTCAAGAACA
GGATGATGACACAAAAATGTTGCTCAATAGGATTACGCTCAGGCTCAACCTGAGAGCAGA
GTTACAAGCAGTCCTTTTGCTGTTGGAGGGTGAATTGCAGGACTCTTCTGAACCTCTCTT
AGGCCCTTGTGCTCTTTCCCCTGAGTGGCAACCTGGACACTCTTAGTGCAAGTTTGCTGG
CAAATAATGCCTGCTAACTAGGACCTGGTCTCATAATCTTCTGGTGTTCAAGTCTGCAAG
GCCATACCTTTGAACATGACCCTGTCTCTTCTGATATCTTGAAATCATCTGGCATCACCT
CTGAGGCCTAGTAGATCAAAAGTCTCAGGTGAGTGAAATGATCATGACTAATGCATTCAC
TTCCTTATGACATATTCCTCAGTATTTTGACCTTTACTCTCAGTCCATCAAAGTTTACTG
AATTCAAATCAATACAAGAGAAGTCAGAAATGAAGTTACAATTCTCAGTATGTTCTGCAA
TGTAGAACCGCAGATTTAAAAACATATAGGAATTCATTTCTACCTATAGTTTGTACACCC
ATAAACTTGAGCTTCGAATAGATGTGAGATGATAATATCTACACATAATGACAGGTCTCC
ACCTTTGCAAACAGGCTTACATGTCCACACTGGTGCAGAGTGATTGATTTCCCACGACAA
TAGATACCCAGGTGCAAGAATCTGGTTTAGTGATGGAGAAATTGGCTATAAATTTCCAAC
AGCACCGGACACCACAAGAATTATTCCAACAAAGTAAAGCTTTGAGCAAATTTTCAAAAA
ACTCTCAGTCCACAGGAAAACTAGCCATGAGGGGAGTTTGAAGTTGAAGGAGTTGCTTTG
GCTTCCACTTCCTTTCCAATTGTCCTCACACTGCTTCATTCTTGAACTACTAAAGTTAAC
TTCAGTATTCATCAGGAAACAAATCCTATCAAGGGCATGGTTTCAGAGGCATGTGGGACT
GAGGAACCTGATGTCACTGGGATACATGCCAACATGGACTGATCTAGTCATAGGAGTTTT
GGTCACATTCTCAGTTTATTCACATGGCAATTACTAAATGCAAACAGGTAGGGATTCATG
ATCGAATATTTGCAGGATGTATTTGGCGAGAAATGATCACAGTCAAGCACAAAGAATTAG
AAACACACGAGTCTCTTGAAAGTCTGTTATAACTATATGTAGCAGTTCACTTATTGTCCT
CCCCATATTACTCAGGGAACTCAATCTGAGTGTTAGTCTCTGACAATGTTAAAGCAATTG
ACAGATGTAATCTGCATAATTGCTTCAAGAGAATGTTGTGAGCCCGTTTCGTAATGCATT
GGGTTTTGGTTCTTTGATTGAACTTAGTCCAGTTAAGGATGTTACCATCCAGGTTGTGGG
GCATTGCAGTATAGAAGAGGTGGCTGAAGAGGGATTCTGCTCAGTGTTATCAAATCTTAG
ACTGCTGATACAGTCTCATTCAAGTTAACGTAAATTTACTAAAAGAAGGGAAACAAGTGC
CCTCACATCTTGCTCTTTCTTCTTGTAGAGAAGATAGGCTTCAAAAATTCAAGCAAGGGT
TCCCGTGATCCCATAAAAGAGATCTCACACCTTTAACCCTCTGCACTTGCAAGTGAGGAT
TCAAACTCTGAGGCAGTATTGGCAGCCCAGGTAAGCCATGGTGCTGTTGATATTAAATTA
CTGGCAGTTGTGTCCTACCTGGGTCTATTTTGACATTTAATCTCAGCCCACCAATGTTTA
CTGAATTAAAATCAATAGAATAAAAGTCAGAAATGAAGGTACAATCCTCAGTATGTTCTC
CCCTGTAGAACTGCAGATCTAAAATTCTGAAATATTACATATTTCTTTCTATGTATAGTT
CCTATACCCATAATCTTTAGCTTCTTGGAATAGATGCAAGACAATAATATCTACACATAA
TGAGGGATCTCCCCCTTTGTTGCTTGCATTTGGAGAAATTTCAGTCCATGAACAGGCTTA
CATGTCCAAGCTGGTCCAGAGTGATCAATTTCACATGACAATGGATACCCAGTTGTAAAA
ATCTGGTTTAGTGATGGAGAAATTGGCTATAAATTTCCAACAGCACCGGACACCACAAGA
ATTGTTCCCTCAAAGTGAAGCTCTGTGCAAAATTTCAAAAAATCTCAGTCCACAGGGAAT
CTAGCAATGAGGGGAGTTTGAAGTTGAAGGAGTTGCTTTGGGTTCCACTTCCCTTCCAAT
TGTTCTCACACTGCTTCATCCTGTACTTAGTAACATTACCTGCAGTATTTGTCAGGAAAC
AAATCCTATCAAGGAGATGGTTTCAGTAGTGGGTGGGGCTGAGGAACCTGATGTCACTGG
GATACATGCCAACACGGCCTGTACTAGCCTCAGTAATTTTGGTCACATTCACTGTTTAGT
CACATGGCAATCACTAAATGCTAACACTCAGGGATCCATGGCCGAATATTTGTCACTTTC
TTCCTGGCAACTGACTCTCTGCAGCATTCACGTACCACCCGTGGGCACTGAGTTTTATCA
TGCAGGATGGATTTGCAGGGGAATGGTCACAGCCTAGCACATAGAATTAGAAACACACAA
GTCTCTTCAGACAGTCTTGAAAATCTATGTGTAGCTGTTCATCTATTGTCCTCTCCATTT
TACTCAGGGAACTCAACCTGAGTGTTTGTCTTTGACGATGTTCAGGCAATTGGCAGATGT
GATATGGGTAATTACTTCAAGAGAATGAAGTGAGCCACTTTTGCAATGCATTGGTCTTTG
GTACTTTCATTGACATTACTATCCAGATAGGGATGTAACCATACAGTGAGTTGGACATTG
TAGCATAGAAGGGGGAGCTGCAAGAGTGATTCTGCTAAGTGGCATCAACCCTTAGAACTC
TTATACAGTCCCTCCCACGTTAACATGATTTTTGAAAAGAATGGTAAGCAAGTACCATCA
CATCTTGCTCTTTCCTTCTATAGAGAAGACAGTCTTCAAAGATTCAAGCAAGGGTATCCC
TGAATCCATACAAGAGCAATCACCCTTATAGCCCTCTGCGCTTAAACGTAACAATTCATT
ATTCTGAGACACTGGTGGCAGCTCAGGTAAGCCATAGTGCTGGTGATATTAAATTTGTGG
CAGTAGAGTCCTGCCTGGTTCTAGGTCAATGATGAGAACAGTAAGTCAAGAACAGGTTGA
TGACATAAAAATCATGCTCAGTATGAACACACTGAGGCCCAAAAAGTAAGACATGGTTAC
AAGCAGTTCTTTTTGTCTTTGAGGACCACTTGCTCTTCTCTTTTGAGCTCCTTTGATGCT
CTTGTGCTCTTTTCCCTGAGAGGGCACATGGACACTGTTAGTGCATATTTGCTGGCCAAC
ACTGCCTGCAAACTAGTACCTAATCTCATATTCTTCTTGTATGCAAGTCTGCAAGGACAA
GCCATTGAACATGACCCTGTCCCCTCTGATGTCTTGCAGTCATCTGGCATCACCCCTGCA
TCCCAGTGGATCACAGAACTCAGGTGAGTGAAAAGTTCATGTCTAATGGATTCACCTACT
TAAGACATATTCCTTCATATTGTGGCCTCTGAATTCCAGCCCATTTAAAGTTTATTGAAT
TAAAAGAATAGAAGAGAAGTCAGAAAAGAAGGCACAACTCTCTGAATGTACTGCCTTGTA
GACCTGCAGATTGAAACAACATGTAGAATTTCCTAACTACCAATAACGCGTACAGCCATA
AACTTGAGCTTCTTGGCATAGGTGCAAGAGGAAAATATCTACCAATAATGGAGGTCTCTA
CCTTTGTTGCTTACATTTGGAGGAATTTCAGGATTATAAGCTGGTGAAGAGTGATCAATT
TCACATGACAATGAAGTCTCAGGTAACAGAGATGGGATTTGATGGAGAAATTGGCTATAA
ATCTCCAACAGGATGAGAAAGCACAATAACTATTACCATAATGCAAACTTTGAGCAAATT
TTCAAAAACCTCAGTCCACAGGGAAACTAGTCATTTGGGGAATTTGAAGTTTCCACTTCC
TTTCCAATTATCCTCACATCCTGAACATACTAATGTTAACTACAGTATTCATCAGGAAAC
AAATCTTATCAAGGAGATGGTTTCAGGAGCAGGCAGGTCTGAGGAACCAGATGTCACTGT
GATACATGCCAACACAGCTTGATCTAGTCTCCGGAAATTTGCTCACATTCTCGGTTTAGT
CACATGGCAGTCATTAAATCCTAACACACAGGGATTCATGGCTGAATATTTGTCACTTTC
TTATGGGCAACTGACTCTCTGCAGCATCCATATTCCAGCATTGGGCACTGAGTTTTTCCA
TGGAGGTTGGATTTGGAGAGGAATGAACACAGCCTAGCAGATAGAATGAGAAACACATGA
GTCTCTACAAACAGTCTGGAAAATCTGTATATAGCTGTTCATTTATTTTCTTCTCCATGT
TACACAGGGAACTCAACACGAGTGTTGATCTTTGACAATTTTTAGGCAGTTGACAGATGT
GATCTGGGTAATTGCTTCGTGAGAAAGAAGTGAGTTGCTTTTGCAATGCATTGGTCTTTG
GTACTTTCATTGATCTTACTAACCAGATAGTGATGTAACCATCCAGAGTGTTGGGCAAGG
CAGTATAAAAGGGGGAGCTGCTAGAGGGATTCTGTTCAGTGTCATCAAACCTTAGAGTGC
TTACCCAGTCTCTTTCAAATTAACATGATTTTATGAAAAGAAGGGAAATCAAGTGCCCTC
ACATCTTGCTCTTTCCTCCTGTATAGAAGACATTCTTCAAAGATTCAGGAAAGTCTTCCC
CTGCATTCATACAAGAGCTATCACCCCTGTAGCCCTCTGCCCCTATAAGTGACAATTCAT
AACTTTGAGACAGTGTTGGAAGCCCAGGTAAGCTATCATCCTGCTGACATTAAATTAGTG
GCAGAGGTGTCCTTCCTGGATCTGAGTCAGTAATGACAACAGAAAGTCAAGAATAGGATG
ATGACATAAAAATCATGCTCTATGGGATTACATTGAGTCCAAACCAGGAAACCGGGTTTA
CATGCAGTCCTTTTGCTCTTTGAGGACCACTTGCGGGACTCTTCTGAGCTCCGCTGAGGC
CCCTGTGTTCTTTCCCTTGAGAAGGAACCTGGACAATTTAATGCATATTTGCTGGCAAAC
ACTGCCTGCAAACTAGCACCTAGTCTCATATTCTTTTTATGTATAATTCTGCATGGCCAG
CCCCATTGATCATGACCCTGTCTCCTCTGATGATTTGCAGTCATCTGGCATGACCCCTGC
AGTGCAGGTGATCACAGTTCTCAGGTGAGTGAAAAGTTCGTGTCAAATGGATTCTCCTAC
TTATGACATATTCATCCATATTTTGACCTTTGAATATCAGGCCGTTGCTTATTGAATTAG
AAACAATATGACAGAACCCAGCATCAAAGATGCAATTTTCCGTATGCCCTGTAGAACTGC
AGATTTAAACAACATATAGTATGTCCTAACTACCAATAAATCTTATATAAATTTGAGGTG
CATTGAATAGGGTATAAGGAAAATGTTTTACCACACTTGGGGTCTCCAACTTTGTTGCTA
ATATTTTGAGGAATTTAAGGACCTCAATACAGGGTTACAAATCTATGCATAGTAATCTAT
TTCCCTTGATAATGGAGGCCCAAGTCAGAGAGTCTTGGTTGCATTATGGAGAATTACTCT
ATATACCTTCAACAGGGCCAGACACCACAAGACATATTCCCCAAAAGCAAAGCTTTGAGC
TAATTTTCAAAAAACTCTTAGTCCTCAGGAACCAAGCTATGTGGAGAAGTGTCAGGAGTT
GCTTTGGGTCCCTCTTCCTTCACAATTTCCCTCACATTGCTTTTTACTGAACTCAATAAA
GTTAGCTGCAGAATTCATCAGGAATCAATTCCTATCAAGGCGATGGTTTCAGTAGACTTG
GTCTGAAGAACCTGATGCCACTGTGATGCATGACAATATGGCCTGATCTAGTCTCATGGA
ACATTGGTCACATTCTCAGTTTGGTACCATGACAATCCATTAAACCTTGTATCCAAGAGA
TCCATGGCTGAATATTTGGCACTTTCTTCTGTGACTCTCTGCAGCATTCACATACCAGCC
TTGGGCACTGAGTTTTACTGTGCAGGTTGGACTTTTAGAGGAATGATCACAACCTTGAAG
ATAGAATGAGAAACACTCAGTTCCTTTCAAACAGTCTAGAAAATGTCTGTTGTTGCTCAT
TTATTTTCCTCTCCATATTACTTGGGAAGTCAACATGAGTGTTTGTCTCTGACAATATTT
ATGCAAAGGACAGATGTGTTCTGGGTAATTGCTTCAAGAGAAAGAAGCCTGTATTGCAAT
GAATTGCTCTTTTGTACTTACATTGACCTTACTAACTGGATAGGAATGTAACCTTCTGAA
GTACTGTCATGGCAGCATAGAAGGGACACCTGCAATAGTAATTCTGCTCAGTGGCATCAT
ACCTGTAGAGCTCTTATACAGTCTCTCACATTAAAACTATTTTCTGAAAAGAAGGACATT
CAAGTGTCTTCACATCTTGCTCTTTCCTCCTTTAGAGAAGACATTCTTCAAGGTTTATGC
AAGGGTTCCCTTGAATCCATAGAATAGCTTTCAACCCTGCAGCCCTCTGTACTTACTAGT
GACCATTCACAATTCCGAGGCAGTGTTGGCAGCCCAGGTTAACCATGGTGTTAAGTGATA
CTAAACTCTGGGTGTCCTGCCTGGGTCTGGGTCAATGTTGACAACAAAAAGTCATGGACA
GAGATGAAGTTATAACAATCATGCTCAATGGAATAATGCTGAGGCCCAACCAGGGATACA
GGGTTACAAGAAGTCCTTTTTCTTTTTGTCGACCACTTGCAGGACTCTTCTGAGAACTTC
TGATGCCTTTGTGTTGTTTCCCTTACAAGGAACCTGGACACCTTCAGTTCATGTTTGTTG
ACAAACACCACCTGATAAGTAGCACCTAGTCTCACATTCTACTTGTGCAAGTCTCTGCAA
AGCCCACCCAATGCTCATGACCCTGTCTCTTCTCATGTCTTGCAGTCATTTAGAATGACC
CCTGCAGCCCAGAGAATCATAGATCTTAGGTAAATGAAAAGATCTTATCTAATGGGTTCA
CCAACTAATGACCTATGCCTCCAATTTTGACCTCTGAATCTCAGCCCATCTAAAGTTTTT
TTTTAATTAAAAACAAAATAACAGAACATGGCAACTAAAGGACAATTCTCAGTATGTTCA
CCCCTGTAGAACTGCAGATTTTCATGACATACAGATTTTCCTAACTATCAATAAATTTTA
CACATCAATTTGAGCTACTTGGCATAGGTGGAAGGGGAAAACACCTTTCTGTACTTGAAT
GCCCTTTTTGTTGTTTACAATTTGAGGAGTTGCAGGACATCAATACAGGATTCCAAGCCT
GTGCCTAGTTTTAAATTTTGCATGACATTGGAGAGCCTAGCACCAGAGTCTGAATTAGTA
AATGAGTAGTACCTATAAATTTCCAACTGGCCTGGTCTCCACGTGTATTCACAAAAAGCA
AAGCTTTGAGCAAATTTTCAAAACCTCTTACCACACAGGGAAACAGTACATGTGGAGAAC
TTGAAGTTTCAGTAGTTGCCTTGGGTACCATTACCTTTCCCACTTCCTTCACAGTGTTTC
ATCCTGCTCTTACTAAACTTCACTATGGAATTCATCAGGAAACAAATCCTATCAAGGAGA
TGGTTCCAGGAACAGGCCTGTTCTGAAGGAACCTGATGTCACTGTGAGACATGAAAACAT
GGGCTGAACCATCTCAGAAACTTTGGTCACCTTCTCAGTATAGTGATGTGGCAATCCATT
AAACCCTAACACAAATGAATCCATGGCCAAATATTAATCAATCTCTTCTCTGCCACTGAC
TCTCTGCAGCATTCACTTACCAGCATTGGGCACTGAGTTTTACGTACAGGTTGGACTTTG
GAGGGGAATGATCACTCCCTTGCAGAAACAAAAGGTACCCTACAAACAGTCTCTAAAATT
TCTATGTAGTTGTTCACTTATCGTCTTATCCATATTACTCAGGAAAGTCAACTTGAGTGT
TGGTCCATGACAATATTTAGGCAAAGAACAGATGTGATCTGGGCAATTGATTCAAGAGGA
AGATGTGAGCCTGTGCTGCAATGCATTGGCCTTTTCCACTTTCGTTGACATTAATAACGA
GATGGGAAGAAACCTGGAGAATGGGCACGGTAGTATAGAAAAGGCAGTTGCAAGAGGGAT
TCTGCTCAGAGGCATCATACGTGTAGAGCTCCTATACAGTCTCTCACATTAAATTATTTT
ATTTTATTTATGTTTTTTTTAATTTTTTATTAGCTATATTTCTTTGCTTACATTTCAACT
GTTATTTCCCTTCCCGGTTTCCTGTCCATAAGCCCCCATTCACTCCCTTCCCCCTCCCCC
ATATGGGTATTCCCCTATACATCCCCTTTACTGCCCCCCCATATTCCCCTGCACTGGGGG
TCCAACCTTAGCAGGACCAAGGGCTTCCCCTTCCACTGGTGCCCCAACAAGGCTATTATC
TGCTACATATGCAGTTGGAGCCCTGGGTAAGTCCATATAAAGTCTTTCGGTAGTGCTTTA
GTCCCTGGAAGCTCTGGTTGGTTGGCATTGTTGTTTTTATGGGGTTGCAAGCTCCTTCAA
CCCTTTCCATACTTCCTTTAATTACCCCCAAGGGGGTCCTGTTCTCAGTTTAGTGGTTTG
CTACTAGCATTGACCTCTGTATTAGACATGCTCTAGATGTGTCTCTTTTTCTTTTCTTTT
TTTATCTTTATTAACTTGGGTATTCCTTATTTACATTTCGATTGTTATTCCCTCTCCCGG
TTTCTGGGCCAACATCACCCTAGCCCCTCCCCCTCCCCTTCTCTGTGGGTGTTCCCCTCC
CCATCCTTCCCCCATTACCACCCTCTCTCCAACAATCCCATTTACTGGGGGTTCAGTCTT
GGCAGGACCAACGGCTTCCCCTTCCACTGCTGCTCTTACTAGGCTATTCTGAATGTGTCT
CTTAGGCAGAGGAATGGATTCAGAAAATGTGGTACATCTACACAGTGGAGTACTACTCAG
CTATCAAAAACAATGACTTCATGAAATTCATAGGCAAATGGAATGAACTAGAAAATATCC
TGATTGCTGTAACTCAATCCCAGAAAAACACACTTGGTATGCACTCATTGATAAGTGGAT
ATTAGCCAAAAAGCTCGAATTACATTATTTTATTAAAGAAGGGCAAACAAGTGCCTTTAA
ATCTTGATCTTTCCTCCTGTAGAGAAGACATTCTCCAAAGATTCAAGCAAAGGTTCCCTT
GCATCCCTACAAGAGCTTTCAACCCTGCAGCCCTCTGCACTTACAGGTGATTATTCATAA
CTCTGAGACAGTGTTGGCAGCCCAGGTAAGCCATGGTGTTAGGTGATATTAAATTATGGG
TAGCTGTGTTCTGCCTGGGTCTTGGACAATGATGACAACAAAAAGTCATGAAGAAAGATG
ATGACATAACAATCATGCTCAGTAGGATTACGCTGAGGCCTAACCATGGAGACAGGGTTG
CAAGCAGTACTCTTTCTCTTTGATGACCACTTAGGAGATCTTCTGAGAATCTCTGATGCC
TTTCTGTTGTTTCTCCTGAGAGGGAACCTGGACAATCTCAGTGCACATTTGTTGCCAAAT
ACTGCATGCTAAGTAGCACCTAGTCTCACATTCTACTTGTACAAGTCTTTGAGGCCCATC
TCTGCAAAGCCCACCCATTGCTTATGACCCTGTCTCTTCTCATGACCCCATCTCTTCTCA
TGACCCTGTCTCTTGCAGTCATTTGCAACCCAGAGAATAATAGATCTTAGGTAAATGGAA
AGATCTTGTCTAATGGCTTCACCTACTAAGTAACTTTGCCTCTACTTTTTGCCCTCTGAA
TCTCAGCCCACCTAAACTTTTTTAATTTAAAACAATATAAAAGAACCCCGCAACTAAGGA
ATAATTCTCAGTATGTTCTCCCCTGTAGAACTGCAGGTTTACATAGCATAAGAAATTTTC
TAATTCCCTACTACTCATATACACATATGTTTGAGCTACTTCGAGTAAATTGAAGAGGAT
AACACCTTCCATTACTGGGGTTCTCCATAGTTGCTTACATTTTGGGAAGTTGCAGGAACT
CAACACAGGCTTTCAAGCCTGTGCCTAGTTTACAGTTTCCATGCCACTTGAGAACATAGA
GAGAGAATCTGATTAGTTTGGGAGTAGTTTATAAATCTTCAACTGGGCTGGACTCCACGT
AATGTCTTTCCAAAAATCAAACCTTTGAATAAATTTTCAAAAAAAATCTCACTCCACAGG
GAAAGTGTACATGTGGAGAAATTGAAGTTTCCGGTGTTGCTTTAGATTACACATTCTTCC
CAATTTCATTCAAAGTTTTTCATCCTGCTGTTACTAACATTCAGTGCAGAATCTATCAAA
AAACAAATCCTTCCAAGGAAATAGTTTCAAGAGCAAACCTGGCCTGAAAGAACCTGATAC
CACTGTGAGGCATGACAATATGGCCTGAACGAGTCTCAGAAACATTGGTAACCTTCTCAG
TTTAGAGATATGGCAATCCATTAAGCCTAACACAGATGGATCCCTGGCTGAATATTGGTC
AGTCTTTTCTGTACAACTAGTCTTGAAAGCATTCACTTACCAGCATTGGGCACTGAGTTT
TACCATGCACATTGGACTTTGCAGAAGAATGATCACTCCCTTGCAGGCTGAATGAGAAAC
AAAGGGTTTGCTTCAAACAGTCTGTAAATATCTCTGAGTAGTCCTTCATTAATTGTCCTC
TCTATGTTACTTGCGTAATGCACCCTGAGTGTTCTTCACTGACAATGTTTAGGTAAAGTT
CAAATGTGATCTATGTAATTGCTTCAAGAGTGAGGCTGTGTTGCCATGCATTGGTCTTTT
GTACATTTATTGACCTTTCTCACAAGAGAGGGATTTAAACATCTGGATGCTGGGAATGGT
AGTATAGAAGAGGCAACTGCAAGAGGTATTCTTCTCAGTGGCATTATAACTTTAGAGCTC
TTATACAGTCTCTCACTTTAAAAGTATTCTATGTAAAAAGGGCAAACAAGTGCCTTCACA
TCTTGCTCTTTCCTCCTGTACAGAAGACATTCCTCAAAGACTCAAGACAGGGTTCCCATG
CATCACTAGAATAGTCTTCAACCCTGCATCCCTTCCCTCTTGCAAGTGACCATTCGTAAC
TCTGAGACAGTGTTGGCAGCCAAGGTAAGCCATTGTGTTAGGTGATATTAAATTATGTAT
AGGTATGTTCTACCTGGATCTGGATCAATGATGACAACAAAAAGTCATGCAGAGAGATGA
TGATAAAAAATCATGCTCAATAGGATTATGCTGAGGCCCATCCAGGGGGACAGGGTTACA
AGCAGTCCTTGTTCTCTTTGAGTACAATTTATGGGACTCTTCTGAAGTCCTCTGATGCCC
TTGTGCAGTTTCCCCTCACCAGGAATCTGGACACTCTCAGTACTCTTTTGTTGGCAAACA
TTGCCTGCTAAGTACCACCTAGTCTCACATTCTACCTGTATGTAAGTCTGTGAGGCATAT
CAACTGCTCATGACCCTGCACTTTATGAGGTCTTGCAGTCATCTGGCATGCCCTTGTATC
CCAGAAAATCACATATCTAAGGTGAGTGAAAAGATCATGTCTAATGACTCCCCCTACTAC
ATCTGATAGAGCTAATATCTAATATATACAAAGAACTCAAGAAGTTAGACACCATAAAAT
CAAATAACCCTATTAAAAATGGAATATGGAGCTAAACAAAGAATTCTAAACTGAAGAATA
TCAAATATATGAGAAGTACTTAAAAATGTCCAATATCCTTAGTCATCAGGAAAACGCAAA
TCAAAAAGCCCTGAGATTCTACCTCACACCAGTGAGAATAACTAAGATGAAAAGCTCAGG
GGACAACAGATGCTGGTGAGGATGTGGAGAAAGAGAAACACTGGTGGTGGGATTGCAAGC
TGGAACAACCATTCTAGAATGCAGTCTGGAGGTTCCCCAGAAAATTCGACATAGGAATCC
CTGAGGATCCTGCTATACCACTCCTGGGCATATACTGAAAAGATGGTACAACATATAATG
AAGACTATGCTCACAGTAGCCTTATTTATTATAGCCAGAAGCTGCAAAGAACCCAGATGT
CCTGTAACAGAGGGATGGATACAGAAAATGTGTTATATTTATGCAACGGAGTACCACTGA
GCTATTAGAAACAATGACTTTCATAAAGGAAATGCAAATAAAAACAACACTGAGATTCCA
CCTCACTCCAGTCACAATGGCTAAGATCAAAAATTCAGGCAACAGCAGATGCTGGTGAGG
ATTTGGAGGAAGAGAAACA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved