Rattus_norvegicus Locus Mono:383:SNORA52
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Mono:383:SNORA52
Rattus_norvegicus
Mono:383:SNORA52
18
SNORA52
1001..1148
2148
gagcaagcaagtaagcagcatcccttgattatctctgtatctgttccttcctccaagat
cctgttctgcttgaggttctgttttgacttcatttgatgataaactgtgttatggccctt
taaattgattacacccttccccctccccataacttgcttttggtcacggtatttattaaa
gcaatagtaaagctaacttagacaaatactaactgggaaagaagtcagcatcttcaacaa
atggttttggccaaactggatgtctgcagaaaaataatgtaaatagatccatacatgtta
ctctgcacaaaactcaactcctcatggattaaggcctgaacataaaaccagatgcattaa
acctgatagaaaagaaactgagaatagccttgaacttgttgccacttgagaagtctgaac
agagcattgttgttttttttttttaagatttttttttatttattccacgtatgtaagtac
actgctgctgtcttcagacacacctgaaggggacatcggatcccattatagatggttgtg
agccaccatgtggttgctgggatttgaactcagggcctctggaagagcagtcagcactct
taaccgcctgagccatctctccagccctgaacagagcattgttaatgtaggtactagacc
aaaaataataaatgggacgtcatgtagctgaaagtcttcgttaaggcaaaggacacagtc
attcagacaaagtgtcagtttatagagtggaaaaaagatttttaccaattctacatccag
tagaggactaatatccaaaatttataaagaactcaagaaaaattaaataatctaaataaa
aggaggattacagttctaaataaaattctcaaatagaagaacctaaaatgtctgggaaac
acttaaagaaatgtttaacatccttagccatcagggaaacacaaatcaaaattactttgc
atgccatcttcatgagtcaggatggccaacatcaacaacactggtaacagctcaatctta
taaaaatttacagccactatggaaatcaatagggcagtttgttgtggaccagagcatcct
agaaaccttgccagagttgtgcaaggcctttttgtttaaggtttgtgcctgcagcgcttc
tgaacacgcctagaaaaaaaaaaaaagaggctgaaggaacgcccattcagagcctgcccc
acatgtggcccacacatatacagacaccaaactagataagatggatgaagcaaagaagtg
caggctgacaggaaaccgatgtagatctttcctgagagacacagccataatttggcaaat
atgtaggcagatgccagcagcaaaccactgaactgagtactggacccccgttgaaggaat
cagagaaaggactggaagagcttgaaggggttaaacaacaatgccaaccaaccagagctt
ccagggactaagccactacccaaagactatacatggactgaccctgggctccaaccgcat
aggtagcaatgaatagcccagtaagagcaccagtggaaggggaagcccttggtcctgcca
aggctggacccccagtgaacaggattcttgggagggagggaggtaatggggggaggatgg
ggaggggaacatccatgtagaagaggagggggaagggttagggggattttggcctggaac
ccgggaaagggaaaaacatttgaaatgtaaataagaaataacccaatttaacaaagatgg
aaaaaatttgaaaaaattgggccgttcctcagaaaattgggaataaatttaccttaaggc
ccagatatatcactcttaggcatatacccaaaggatatttgctcgaccttgttctttgct
gctctaattatattattcagaaactagaagcaatgtagatgtccatcaacaaaagaatgt
attaaaaaatatggtctgtttatatgatggattattactattactcagttgttttattat
taatgacatcatgaatttgcaaatggatggaactaaaataaaaaatcatcctgagtgagg
taacacagacccataagagttaatgtgggttgtatttaacttatatttggctatcagcca
ttaaataataataaccatcctacagagaagttgggtatagaaggtggaa
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved