Rattus_norvegicus Locus Poly:2:SNORA43
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Poly:2:SNORA43
Rattus_norvegicus
Poly:2:SNORA43
3
SNORA17, SNORA43
1001..1132, 2276..2406
3406
CACTAAGAACTTGGAAAGCAGCGCTGCCCCCACCAAAAACAAAAAAAAACAAAAAACAA
AAAACAGGGAGTTTCGTAAGGAGGCGCAGGACTTCATGGGTCGTTTGAAAAGTCTTGTGC
GCTTGTCAACACTCGAAATTAGTCTCTCAGATCCACTTGGCAAGGCAGAATGTAGGACCA
AGCAATACAGAAGTCCTTGAGCTTCTGGAGGACTGGCCTATGACGCGCCGGCGAGGAACA
AAGGGGTCACTAGAGGGCGCTGCACTTGGAGGACAGCGAGAGTCCCTCGCAGGCTGCCGT
AGTCGCTTCTATAAAGGACGTGGCGTGGGGCTGCTCGGCCTCTCAGCGGCCATGACGGTG
TGGTGTGTAGGTTCCTATCGTTATTGCTTCCGTTGTTGGCCTGGGGCGCCGCGGATGACC
CTACATAGCCCTTGGCCGGCCACCGGGAAGATTGCGTCTCGTACTGACGATCGTAACAAA
GACGCACCGTGCTTTCCTTCTGAGGGTTTAGTCGCCCTAATACGTGCAGCAGACTAGTCA
TGTGGTAAGGGGAAGGATAGTTCATGATGTGCCCGAGGGCCGGGTGGACGGCCCCCAGAA
GTCCCAGGAGTGAAAGCCGAGGGTCCTGTCTGGGCTAGTACGCGGGAAGCCCTGGGTGGG
GCTCTAGAGGGGTGCCCCCTTCCTGTTTAGCGTAATGCCGCAGAGTTGGAGAGACAGGAG
AAAGCGGCGCAAATTTATTTGTAGAAAGCCCTAGCAAGGACAACAAATCTGTGGACTCAT
TGGAGTAGGGATAAAATACAGGCCTGGTGCAGTCTCCCAATGTGATGTTGCCGAGGTGTG
TGCAGAATGATCGTTCCCTTCCTTTCCTTCTCTAGGAAGTTTGTCTGCTGAAAGTAAGCG
CCCTCCCGGGAGGATGTGTTGAACTTTTGGGTAAGTTGACTTAAAGTTACGAAGTTTCGG
ATTAACGGTCGTGGTGTGGTACCAGGCACTTGGTTCAAGACCCTGCCCCTAGAGGCGTTG
CAGGTGTGGCGGCTGTGTCACATTTGTGTCAGTAGGTGGCGGAGAGGAGAGAGGCTATGT
CTACGCTCAGTGTTCTGACCGGTGAACATCTGAATGATTTGTAGCCTGACAATGCTCCCT
AAAGCTGGAGGTGGGATTGTCGCCCCCGGTTGATGGCTGGCTTAGGTCATTTGATGGTTC
TGCATATACCCAATAGAGGGGCCCGTCTGTAAAGAGAAGTTTCAGATAATTTGGTCTGTT
GGAAATCGTGGAACCAGTAACCCTCAAAAGATCCTGGGACACAGTTTGGGTCAAGAGACT
GTCTCAAGTAACAACAGTGGATTAGTTAGGGGTTTTTATTGCTGTGAAACGCCATTACCA
AGAAGCAAGTTAGGGAGGAAAGGGTTTATTCAGCTTACACTTACACGTTGCTGTTTATTG
CCAAAGGAAGCCAAGGCAGGAACCTGGAGGTAGCTGGTGCAGAGACCGTAGGAGTGCTGC
TCTGCCTGTACAACTGTTCCAGAAGAGGCCATCAGAGCCTATTATAAACTACCGCGTGGT
TGCTGGGAATTGAACTCCGCCTTCAGTGCTCTGAACCACCACTCCAACTCCAATCAAGGG
ATTGGGCTTTGACCTCTGCCTGGTTTTAAAGGCGTGCTCCGCCACCGACCCAGGAATGGC
ACCGCCCACAATGGGCTGGTCACTAATTGAGAAAATGCCTTACAGCTGGGCTCACCCGTA
GGCATTTCCTAAGCTGAGTCTGATGACTGGAACTTGTTCCAAGTTGGCACAGAAACAGCC
AGTATAGCCCCAAAGCTTTCCTTTGAGGAGATGAGTGGAGTTACTAGCTAAAGCTCTGAA
GTGCTTGGCCGGCTATGTTGATGTGAGAAGATGGGTTTTCAAACTAGATATCTCCGCTGC
TTGCTGGCTGGTGCCAGAAAGGCAGACTGCACGTTCTGTGGCCTTCACAATAGCAGGGCT
GGAGTCTCCATCCCTGGTACCACAGGCAAGCGAAACTGATAATGGGGAGGGAAGTAGTGC
CTGGTAATAGGTTCATGTTGCACCGTGACTTCAGAATATGGGAGTATAGTGGGACAGCTA
ACAGTGGTGGTGCAGCGCATGGATTAAGAGGGTCTACATTGTTTTCTTTGATACAGGAAG
GTTGGTGACTAAACTCTGCTTGTGCTAACTGCCCAGCAATGACTCAGTTGAGGTAAGAGG
TGGGCTGGACCCACTGGAGCGTGCTCAGATGGGATGTACGTGGCTGCCTTGAAGATGCTG
TCCTAGAACAGCACCACAGGCCTGGCTCGGCTTTGCCTGTGACATTGGGGCAAAGAGCAA
GTGGCTATTTCTACGCTCAGTGTTCAGAAGCCAGTGAGCACTAAGAATGGTTTGTAGCCT
GACATTTTGCAGAGCCACAGTGGAATGGCACTGGGGTTTGGCTTTGCTGTTGGCCAGATG
CCAAGCCTCTAGGGCTCACCAAAGGGTCACATGGTCAGCATTTTAGCAAGACAGAACTTT
GGAGGTGTGTGTGAGTTTTCTAGAAGACCTTCTGAGAAGCTGGGAAAATACAAGAAATTA
TCCGTCCTTTCTTCATCTTCCAGATCCAGAAGCCAGGAAGAAGGAAGGGGGCCTACTTAT
TGGCCAAGATGGCTGATCGGGATGAGTGCAGATATGATTTTAGGCCGTGGGCCTGAGGTA
TGTCCTCTGACCTCACCAGTGTCCTACAGAACTCCCCATATGGCTTTGGGCAGCTCTGAA
CTTAACTCTGGTAGCCAGCCTATGTCTTAAGTTATGGACTGGATTTGGGTTGGCCTGGGT
TTGACTGGTCTGTGTGTGGTAGTGGCACTGGAGATGGGGAACCTCTAAAACTCAACATCT
CTACCTGACTGTACACGGTCTTAAAAGATATAATTATGAGTTGGGGGGGGGGGTTGGGGA
TTTAGCTCAGTGGTAGAGCGCTTGCCTGGCAAGGCCCTGGGTTCAGTCCCCAGCTCCGAA
AAAAAAGAAAAAATGAGTTGGGGGGGGTGATAGTGGTCCCTCCCTATAGTTGAAGGCCAG
CCTGGTCTACAAAGCAAGTTCCAGGGTGGCCAGAACTATTAAACAAATAAACCCTGTCTT
GAAAAACTAAGAAGGAGAAAGAGTGATCTAGGAGGGGAACTGGCTGTAGTAGATGCTGTG
ACATAAATAAACTTGTCAATTTTTACGGCTGGAATCTTCCTTTGCTATTAAGTTTCTTCT
CGTCTATCTCCCCTGGAAAATAAAGCATGCCAGAGTGAATGGTAAGATTTGAGGTTTAGT
TTGGGCTGGAACTGGCTTTTAACAGGAGCTAAGCTTTCTGCATACTGTGAGCAAACATTT
CCCCTAAGCCAGGAGACTGGTGGGTGGGGGGTGAGGCACAAGGACAG
  Untranslated Region
  Coding Sequence
  snoRNA
AC_000071.1
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved