Rattus_norvegicus Locus Mono:160:SNORD87
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Mono:160:SNORD87
Rattus_norvegicus
Mono:160:SNORD87
5
SNORD87
1001..1085
2085
TGGCGGGAGTCCCTTTGTGTTCCCAAGAAAAGCCACCGTGCGGCCTGTTTCAGGCTTCC
TAAGTGGATTATCAATTTTTCCATAGGAAATATTACAGAGGCGGAGAATATTGTTTCTTA
GCTATTAAGACCGTCAAAGGTTAATGTTTGATCTGAACTATTGGCGGCACTTTAAAACGC
TTTTATTCCTGGATCACCCCTGTAAGTACGGTCTAAAAGAGAGCAAAATTTTTGAAAGCC
ACACAGGGTTGCGATGTTGGCTAAAAGAAGGTGGTAGTGTTAAGTTCTGAAGCACACGCA
TTCAAGAGAGCACACCAGTTGAAAGTCATAAGACGTTTCCAGTAATTGGTTCAGTCATTA
CTTCTCTTGGAGTTCTGTAGGACATGACTTGTGATTCAGGCCCTGCCGTTTGCTGTTTTA
ATGTGCAGGTGATGGCCTGCATATATAGCCTCTTAGCTTTTCACTGTAAGCCCCAAGATG
AGCAAAGGCTTGGTTGAATCCTCTAAGTCTGTACTGCCACAGTGAGGGGCTAAAAGCTCT
TTCTGTCTGTGATAGATGGGTGAGGGGACAGGAACTCAAGCCTTGCAGGAACCTGAAGTG
AGCAGAAGCAGAGGCCGTGGAGTAATGATGTAGAGCTCAGGACCTCCACCCACAAGGGGT
CACCCCAGTCACTGATTATGAAAATACCTTACAGGTTTGCCTACAGCCTTATCTTAAGCA
GGCTCCCTACACCAGTGACTAGCTTCTGTCAAGTTGTCAGAAAAGTAGCCAGTGCACACT
CAGACAAGGTACTAAAACATGGAGCTAAGTTGGGAGTTCACGATCAAATATTTTAATTTT
TAGGTGCAACAAAACCTGTCTCTTTTGAGGGTGCTTGAGCAAATGTTTTTGAAACTTGTC
CTGTCCTGGAAAGTGATTGGAACAAGCTGCCAGAACTACGGTTACCAATAACAAGGTACA
CATCTTTTTCTTTGTGGTTTGATTAACATGGGGCCTTAATAGCTGGCACAATGATGACTT
ATGTTTTTGCCGTTTACCCAGCTGAGGGTTTCTTTGAAGAGAGAATCTTAAGACTGAGCT
GCCAGCAATGTATAGATGGTGCAGATGACTAACATGTGGTGTCATTGTTAAATGGTGACT
GTTCTCCCCAGCATGTAGGTAGCTGCAGTGAACGTCCAACTTCGGGAGCTGTGATGTTTA
ATCCTCGTTGTTTTGGGTAAGTTTGTTCTGTCAGTCATGTCCGTTGATTGAATAGTATTT
GATAACACTGAGACTAGAGCCAATTCCTTTTGAAGAACATTAGTGTGAGCTTGAAGAAAA
ATGATTTTGGGGGGGGGGGCTTCTGACTGTCCTTTTCTTTTTGGAAGGTCCAGCACACAG
TTTGGAATGTAAAATGAAGACTTGGTCAAGAAACCATGAAGGGGGGGGCCTGGAGAGATG
GCTCAGTGGTTGAGCATCGACTGCTCTTCCTGAGTTCAAATCCCAGCAACCACATGGTGG
CTCAACAACCATCTGTAATGAGATCTGATGCCTTCTGGTGTGTCTGAAGACAGCTACAGT
GTACTCATATATAATAAGTAAAATATTAAAAAAAACCATGAACGGAAGCAAATGGTGAAA
ATTAGTATTTAATTTGGTATCAATATGTTATGTAGAAATAAACGATTTTAATTGCTATGA
GCATTAGTTTCTTTAAAATGCGTGTCTTTAAAACACCATTCTCATAGTAAAATAAACCTC
ATCCTTCATGAGCTGCAGACTTCATTTACTTTTTGTCAACACAAGCAATCCTGATGGCCA
GTACACCAATACACCGTGGGGAAGAAAGTGACTAGACCACTTGAGAACTCTTAAGACTGG
TTTTCCTCTGGTGAAGACTTGGCAAAGTCTTTAACCACTAGAATCCCTAAGTTTAGTAAA
TAGCTTAAAAATTGAGCAACATGGTAATGACTTGGGGCTTGCAAGGGGTGGGGAAGTGGT
TTCTTAGCTGGCACAGAACTCTGGATTTGATTCCCTGATAGGAATTCCTAATGTTAGACT
TGCCAGTTGTGGCTGTTTTTGCTCTTTAAGAATTGTTTTGTTCTTC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved