Rattus_norvegicus Locus Mono:272:SNORA51
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Mono:272:SNORA51
Rattus_norvegicus
Mono:272:SNORA51
20
SNORA51
1001..1134
2134
GGATCAGGAGCCTACACCCTTCATTCCTTTTTTTCCTGTGGTAACTTTCTCTTTGGTTC
CTTTCGGGGGAGCCCATCCTTATGGTGGAGTTCTCCCTCAGTTGCAGGGTGAAGCAAAAG
TATCAGTCTTAGGTATATCAATAAGTCATACCCTTTGGTTCAAGGAGAAACACAAGTCCA
TTGCAACCAGTCACAAGGAGACCCAGCTGGGAAAGTGGAGAAATTCCTGTGATACCTCAG
GAACTTTCAAGAGGTGAAGTCATTGGTTTTATAGCTCCTAGAGCAATCATCCTGTTAATC
TTTTGAGAAGTGAGCCAACCAGGGGAGATGAAGGGGGGAAAGCTTATTTTGTCAGCACTT
TTTCAAATCCTGTGCCCAAAGCTAGCCCTACCCTTAAACCTGTCAGTTCTATGAGCCAAT
AAACCTTCTTTCTGCCCCACCTGCTTGGACTAGTCTGGAAGTTACTGGGCCGAAATACAC
AATTTACTAAAAAAAAAAAAAAAAATCAGTCAACCAACTGAGACAGGTCTTGCAACCCAG
GCAGACAGACAGAGGACAACCTCTAGACACAGTAGACCTTTAGCCTGCTCTGGGACATCA
CAACTCCTGTGGCTCCTAGTAGGGAACGCAAGCCTCATCTTCTACCATCCTCTGCAGTCA
ATCAAAGTCTGCACCCAAGAGGCCTAGTGTGAGCCACCTGGATGTTCACACAGCCTCGGC
TGCTCTGCTGTTCAGCACGAGGCTAGATAGTCTCTTGACTCTCCTGAGCTTCTATATTGT
TATAAAGAAATAAAGGTGTGGATTTCAGAGCTGTTCACAAGACCGGAAGTAAGGTTCAGC
AGATGTGCCAGCATAGTTAATGTGCAGTATTAAGCCATTGCTATTAACTTGCTATGTAGT
CAAGGCTAACTTAAGACTCCTATTCTTCTTTCTCTACCTCCTGAGTGAGGGGATTCCAAC
CAAACCCCAGCTAAACCAGTGTTTCTACAATCAAGGACGGTGACCTCCTCATGCTCAACG
ACAGGTTGTATTCCTATTCTGTGCGTACAGAAAGAGGAGGCAGAGTAAACCTACCCCATG
CACATCTCAGCCCAGGCTACTGTACCTGGTACGTCTTGTGAGAGGGGAGAGCTGGAGTGG
GGGTGGGGGTGGGGTATCACAAATGGAAGGTATGGTACAGTGGCATGCAACTTTGATCCC
AGCACTGGGGAGTCCGGGGCAGAGGCAGGTGGATGTCTGAGTTCTAGGCCAGCTTGGTCT
ATACGTGAGTGTTGTAGGGATGGGGTGAGGCTCTGTCTCAAAAAATAAGTAAATACCCAC
GAGTGGAGTCAGAGAACTCAACATCCACCCATGAGAGAAGGAAGTTCTGACTATTCATAT
TGGGTGGCGGTGAATCGGCAAACTAATAGGGAGTTTCCATTTTTCGTCAACGGTGAGACG
CCTAGGACACTCTACCTTAGCATCTCTGACACGTAGTCAGTGACATGTATCATTTAACTG
GAAACATAGTCTTCCATGTAGAATATAAACCAAGGATATACCAAGCAACTGAAGGGTCAC
ATATTTGATGAGTGATGTATTAGGATTCTCTAGAGTCACAGAACACGAACGAACACACAC
GAGCACGCGCGCACGCACACACGCACACACACGAGGATTTACTGGAATGACTTACAGGCC
GCAGTTCAGATAGTCCAACCATGGCTAGCTGTGAAGGGAAAGCCCAAGAATCTAGAAGTT
GCTCAGTCCTACAAGGCTGGATGTCCTCATATAAACTTCCAGTAGAAGGTATGGCCCACA
TTCAAGGTATGTTTTTCCACCTCAAGATCCAAATTAAAGGTCTGTGTCTTCCAGACTTAA
AACCTAGATCAAAGTTACGTTGTCTTCCTATCTCAAAGGTACGCACTATGAGTAGATTAA
CCCTCTTCAAACCAGACAGGAAAACCTCTCACAGGTATGCCCTCCATTTCTGGGTGGTAG
TTCATTCCAGACAGTCAAGGTTGCCAACCAAGAACAGGCACCACAGGTGGCCTTTCTCCT
ACAGAGCTCTGAAGGATTGCCTTTCTAATATGCGTCTCATTCTGTTTACTGTCTTGCTTC
AAAACACACAAGGCAGGGCATTCAGCCCCAAATCC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved