Rattus_norvegicus Locus Poly:17:SNORD115
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Poly:17:SNORD115
Rattus_norvegicus
Poly:17:SNORD115
1
SNORD115, SNORD115, SNORD115, SNORD115, SNORD115
1001..1078, 2840..2916, 4674..4751, 6507..6584, 8345..8422
9422
GAGATGGATTTCCAATGGCAAGGGGAACCCAGGAATAAGACTTTAGTTTAGAGATGAAG
AAATTGGCGATAAATTTTCTGCATCAAAAGACACTCCAAGAATTATTGCCCCAAAGGGAG
CTTCGCGTAATTTTTCACGAAACTCTCAGGCCACAGGGAACCTAGCCAGTAGGGTAGATT
GAAGTTGAAGGTGTGGCTTTGGCTACCAATTCCTTCTATGTGTCATCACACAGCTTCATT
CTTGATCTTACTATAATTTACTTCAGTATTCATCAGAAAACAAATGCTATCAAGGAGATG
GTTTCTGGAGCTCTTGGGACAGAGGAACGTGATGTCAATGGGATANNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNCNTANATCTTAAATGCACAAGTCTCATGAAAATTTGATTAAAGTATAC
GTAACTGTTCGTGTATTGTCCTTCCAATATTACTCAGGTAAATTCACCTTTGCCTTGGTT
TCTGACAATGTTTAGCAATTGAAAGATTTGATCGGTGTATATGATCAAGAGCATGTGTCA
TCCCCTTCATCAATGATTTGGTTTTGGGTACCTATTGACCTATTGATCGCTTAGGGAAGT
AACTTTCCATGTGTTGGGAATGTCAGCATGGAAGTGGATGTTGCAAGAGTGATTCTGCTA
AGTGGCATCATACATTAGACTTCTTAAACAGCCTCCTTAAAATTAATATGATTGTATGAA
CTGAAGGGATACAATTGCCCTCACATCTTGCTCTTTCCTTTTTAGAGAGGACAGTCTTCA
AATTCAAGCTAGGTCTACCCTTATTCCACACAAGAGCGCTGTGCCCTTGTACCCTCTGCA
CTTGCAAGTGAGGATTCAAATTCTGAGGCAGTGTTGGCAGCCAAGGTAAGCAATGGTGCA
GGTGAAATTACATTATTGACAGTTGTGTCCTACCTGTGTCTGGGTCAATGATGACAACAG
AAAGTCAAGAACAGAATGATGACATAAAAATCATGCTCAATAGGATTACGCTGAGGCCCA
ACCAGGGAGCCAGGGTAACAAGCACTACTTAGTCTCTTTGAGGACCACTTGCGGGACTCA
TCTGAGCTGCTCTGATGACCTTGTGCTCTTTTCCCTCTGTGGGAACCTGGACAATCTTAG
TGCAACTGTGCTGGCAAACACTGCCTGCCAACTAGCACCTAATCTCATAATCTGCTTGTG
TGCAAGTCTGCAACACCAACCCTGTCATCATTACCCTCTCTGCTCTGATGTCTTGCAGTC
ACCTGGCATCACCCCTGCGGTCCAGTGGATCACTATTCCCAGGTGAGTGAAATGATCACG
ATTAATATTTTGGAGTAATTATGAGATATTCCTCAGTATTTTGACCAATAATTTCAGCCC
ATCAAAGGTTTCTTAATTAAAAATAATGCAATCCCAGTCAGAAATGAATTTCACTTCTCA
GTATGTTTTGTCCCTTTGAACTGCACTATTAAAAATGTAGAGAAGTTCCTTTCTACCTGT
AGTTCATACAGCCATAAAATTGAATATCTTGGAAGAGATCCTAGATGATACTATCTACAC
AAATGGAGGGATCTGGAATATGAATATACCTTTTGAATTTGGAGAAATTTCAGTCCACAC
ACAGGCTCACAAATCAAAGCTGGTGCACAGAGATGGATTTCCAATGGCAAGGGGAACCCA
GGAATAAGACTTTAGTTTAGAGATGAAGAAATTGGCGATAAATTTTCTGCATCAAAAGAC
ACTCCAAGAATTATTGCCCCAAAGGGAGCTTCGCGAAATTTTTCACGAAACTCTCAGGCC
ACAGGGAACCTAGCCAGTAGGGTAGATTGAAGTTGAAGGTGTGGATTTGGCTACCAATTC
CCTTCTATGTGTCATCACACAGCTTCATTCTTGATCTTACTAAAATTTACTTCAGTATTC
ATCAGAAAACAAATGCTATCAAGGAGATGATTTCTGGAGCTCTTGGGACAGAGGAACGTG
ATGTCAATGGGATACTTGCAAACACCAACTGATCTAGTCACACGAATTTTGGTCACATTC
TGAGTTTCATCACATGGCAATCACTGAGTGCTAACGCTCAGGGATTCATGGCCAAAATAC
CTGTTGCTTTCCTCTGGGCAACAGATTCTCTTCAGCATTCACATACCAGCTGTGGGAACT
GATTGTTACCATGCAGTATGGAAATGGGGAGGAATGAACATAGCCTAGCACATAAAATCT
GAAATGCACAAGTCTCATGAAAATTTGATTAAAGTATACGTAACTGTTCGTGTATTGTCC
TTCCAATATTACTCAGGTAAATTCACCTTTGCCTTGGTTTCTGACAATGTTTAGCAATTG
AAAGATTTGATCGGTGTATATGACAAAGAGCATGTGTCATCCCCTTCATCAATGATTTGG
TTTTGGGTACCTATTGACCTATTGATCGCTTAGGGAAGTAACTTTCCATGTGTTGGGAAT
GTCAGCATGGAAGTGGATGTTGCAAGAGGGATTCTGCTAAGTGGCCTCATACATTAGACT
TCTTAAACAGCCTCCTTAAAATTAATATGATTGTATGAACTGAAGGGATACAATTGCCCT
CACATCTTGCTCTTTCCTTTTTAGAGAGGACAGTCTTCAAATTCAAGCTAGGTCTCCCCT
TATTCTACACAAGAGCGCTGTGCCCTTGTATCCTCTGCACTTGCAAGTAAGGATTCAAAT
TCTGAGGCAGTGTTGGCAGCCCAGGTAAGCCATGGTGCAGGTGAAATTACATTATTGACA
GTTGTGTCCTGCCTGTGTCTGGGTCAATGATGACAACAGATGTCAAGAACAGAATGATGA
CATAAAAATCATGCTCAATAGGATTACGCTGAGGCCCAACCAGGGAGCCAGGGTTAAAAG
CACTACTTAGTCTCTTTGAGGACCACTTGCGGGACTCATCTGAGCTGCTCTGATGACCTT
GTGCTCTTTTCCCTCTGTGGGAACCTGGACAATCTTAGTGCAACTGTGCTGGCAAACACT
GCCTGCCAACCAGCACCTAATCTCATAATCTGCTTGTGTGCAAGTCTGCAACAGCAAACC
TGTCATCATTACCCTCTCTGCTCTGATGTCTTGCAGTCACCTGGCATCACCCCTGTGGTC
CAGTGGATCACTATTCCCAGGTGAGTGAAATGATCACGATTAATGGATTGAACTTCCTAT
AAGATATTCCTCACTATTTTGACCAATAATTTCAGCCCATCAAAGGTTTCTTAATTAAAA
ATAATGCAATACCAGTCAGAAATGAATTTCACTTCTCAGTATTTTCTGTCCCTTTGAACT
GCACTATAAAAAATGTAGAGAAATTCCTTTCTACCTGTAGTTAATACAGTCATAAAATTG
AATTTCTTAGAAGAGATCCTAGATGATACTATCAACACAAATGGAGGGATCTGGAATATG
AATATACCTTTTGAATTTGGAGAAATTTCAGTCCACACACAGGCTCACAAATCCAAGCTG
GTGCACAGAGATCGATTTCCAATGTCAAGGGGAACCCAGGAATAAGACTTTAGTATAGAG
ATGAAGAAATTGGCGATAAATTTTCTGCATCATAAGACACTCCAAGAATTATTGCCCCAA
AGAGAGCTTCGCGAAATTTTTCACGAAACTCTCAGGCCACAGGGAACCTAGCCAGTAGGG
GAGATTGAAGTTGAAGGTGTGTTTTGGCTACCTATTCCCTTCTATGTGTTCACACTGCTC
CATTCTTGGTCTTACTAAAATTTACTTCAGTATTCATCAGAAAACAAATGCTATCAAGGA
GATGGTTTCTGGAGCTCTTGGGACAGAGGAACGTGATGTCAATGGGATACTTGCAAACAC
CAACTGATCTAGTCACACGAATTTTGGTCACATTCTGAGTTTCATCACATGGCAATCACT
GAGTGCTAACGCTCAGGGATTCATGGCCAAAATACTTGTTGCTTTCTTCTGGGCAACAGA
TTCTCTTCAGCATTCACTTACCAGCTGTGGGAACTGATTGTTACCATGCAGTATGGAAAT
GGGGAGGAATGAACATAGCCTAGCACATAAAATCTGAAATGCACAAGTCTCATGAAAATT
TGATTAAAGTATACGTAACTGTTCGTGTATTGTCCTTCCAATATTACTCAGGTAAATTCA
CCTTCTCCTTGGTTTCTGACAATGTTTAGCAATTGAAAGATTTGATCGGTGTATATGGCA
AAGAGCATGTGTCATCCCCTTCATCAATGATTTGGTTTTGTGTACCTATTGACCTATTGA
TCGCTTAGGGAAGTAACTTTCCATGTGTTGGGAATGTCAGCTTGGAAGTGGATGTTGCAA
GAGGGATTCTGCTAAGTGGCATCATACATTAGACTTCTTAAACAGCCTCCTTAAAATTAA
CATGATTGTATGAACTGAAGGGATACAATTGCCCTCACATCTTGCTCTTTCCTTTTAGAG
AGGACAGTCTTCAAATTCAAGCTAGGTCTACCCTTATTCCACACAAGAGCGCTGTGCCCT
TGTACCCTCTGCACTTGCAAGTGAGGATTCAAATTCTGAAGCAGTGTTGGCAGCCCAGGT
AAGCCATGGTGCAGGTAAAATTACATTATTGACAGTTGTGTCCTGCCTGTGTCTGGGTCA
ATGATGACAACAGAAAGTCAAGAACAGAATGATGACATAAAAATCATGCTCAATAGGATT
ACGCTGAGGCCCAACCAGGGAGCCAGGGTTACAAGCACTACTTAGTCTCTTTGAGGACCA
CTTGCGGGACTCATCTGAGCTGCTCTGATGACCTTGTGCTCTTTTCCCTCTGTGGGAACC
TGGACAATCTTAGTGCAACTGTGCTGGCAAACACTGCCTGCCAACTAGCACCTAATCTCA
TAATCTGCTTGTGTGCAAGTCTGCAACACCAACCCTGTCATCATTACCCTCTCTGCTCTG
ATATCTTGCAGTCACCTGGCATCAACCCTGCGGTCCAGAGGATCACTATTCCCAGGTAAG
TGAAATGATCACGATTAATGGATTGAACTTCCTATAAGATATTCCTCAGTATTTTTCTAA
TAATTTCAGCCCATCAAGGTTTCTTAATTAAAAATAATGCAATCCCAGTCAGAAATGAAT
TTCACTTCTCAGAATGTTTTGTCCCTTTGAACTGCACTATTAAAAATGTAGAGAAATTCC
TTTCTACCTGTAGTTCATACAGCCATAAAATTGAATATCTTGGAAGAGATCCTAGATGAT
ACTATCTACACAAATGGAGGGATCTGGAATATGAATATACCTTTTGAATTTGGAGAAATT
TCAGTCCACACGCAGGCTCACAAATCGAAGCTGGTGCAAAGAGATGGATTTCCAATGGCA
AGGGGAACCCAGGAATAAGGCTTTAGTTTACAGATGAAGAAATTGGCGATAAATTTTCTG
CATCAAAAGACACTCCAAGAATTATTGCCCCAAAGGGAGCTTCGCGATATTTTTCACGAA
ACTCTCAGGCCAGAGGGAACCTAGCCAGTAGTGTAGATTGAAGTTGAAGGTGTGGCTTGC
TACCAATTCCCTTCTATGTGTCATCACACTGCTTCATTTTTGATCTTACTAAAATTTACT
TCAGTATTCATCCGAAAACAAATGCTATCAAGGAGATGGTTTCTGGAGCTCTTGGGACAG
AGGAACGTGATGTCAATGGGATACATGCAAACACCAACTGATCTAGTCACACGAATTATG
GTCACATTCTGAGTTTCATAACATGGCAATCACTGAGTGCTAACGCTCAGGGATTCATGG
CCAAAATACTTGTTGCTTTCTTCTGGGCAACAGATTCTCTTCAGCATTCACTTACCAGCT
GTGGTAACTGATTGTTACCATGCAGTATGGAAATGGGGAGGAATGAACATAGCCTAGCAC
ATAAAATCTGAAATGCACAAGTCTCATGAAAATTTGATAAAGTATACGTAACTGTTCGTG
TATTGTCCTTCCAATATTACTCAGGTAAATTCACCTTTGTCTTGGTTTCTGACAATGTTT
AGCAATTGAAAGATTTGATCGGTGTATATGGCAAAGGGCATGTGTCATCCCCTTCATCAA
TGATTTGGTTTTGGGTACCTATTGACCTATTGATCGCTTAGGGAAGTAACTTTCCATGTG
TTGGGAATGTCAGCATGGAAGTGGATGTTGCAAGAGTGATTCTGCTAAGTGGCATCATAC
ATTAGACTTCTTAAACAGCCTCCTTAAAATTAATATGATTGTATGAACTGAAGGGATACA
ATTCCCCTCACATCTTGCTCTTTCCATTTAGAGAGGACAGTCTTCAAATTCAAGCTAGGT
CTCCCCTTATTCTACACAAGAGCGCTGTGCCCTTGTATCCTCTGCACTTGCAAGTGAGGA
TTCAAATTCTGAGGCAGTGTTGGCAGCCCAGGTAAGCCATGGTGCAGGTGAAATTACATT
ATTGACAGTTGTGTCCTGCCTGTGTCTGGGTCAATGATGACAACAGAAAGTCAAGAACAG
AATGATGACATAAAAATCATGCTCAATAGGATTACGCTGAGGCCCAACCAGGGAGCCAGG
GTTAAAAGCACTACTTAGTCTCTTTGAGGACCACTTGCGGGACTCATCTGAGCTGCTCTG
ATGACCTTGTGCTCTTTTCCCTCTGTGGGAACCTGGACAATCTTAGTGCAACTGTGCTGG
CAAACACTGCCTGCCAACCAGCACCTAATCTCATAATCTGCTTGTGTGCAAGTCTGCAAC
AGCAAACCTGTCATCATTACAATCTCTGCTCTGATGTCTTGCAGTCACCTGGCATCACCC
CTGTGGTCCAGTGGATCACTATTCCCAGGTGAGTGAAATGATCACGATTAATGGATTGAA
CTTCCTATAAGATATTCCTCACTATTTTGACCAATAATTTCAGCCCATCAAAGGTTTCTT
AATTAAAAATAATGCAATACCAGTCAGAAATGAATTTCACTTCTCAGTATTTTCTGTCCC
TTTGAACTGCACTATAAAAAATGTAGAGAAATTCCTTTCTACCTGTAGTTAATACAGTCA
TAAAATTGAATTTCTTAGAAGAGATCCTAGATGATACTATCAACACAAATGGAGGGATCT
GGAATATGAATATACCTTTTGAATTTGGAGAAATTTCAGTCCACACACAGGCTCACAAAT
CCAAGCTGGTGCACAGAGATCGATTTCCAATGTCAAGGGGAACCCAGGAATAAGACTTTA
GTATAGAGATGAAGAAATTGGCGATAAATTTTCTGCATCATAAGACACTCTAAGAATTAT
TGCCCCAAAGAGAGCTTCGCGAAATTTTTCACGTAACTCTCAGGCCACAGGGAACCTAGC
CAGTAGGGGAGATTGAAGTTGAAGGTGTGTTTTGGCTACCTATTCCCTTCTATGTGTCTT
CACACTGCTCCATTCTTGGTCTTACTAAAATTTACTTCAGTATTCATCAGAAAACAAATG
CTATCAAGGAGATGGTTTCTGGAGCTCTTGGGACAGAGGAACGTGATGTCAATGGGATAC
TTGCAAACACCAACTGATCTAGTCACACGAATTTTGGTCACATTCTGAGTTTCATCACAT
GGCAATCACTGAGTGCTAACGCTCAGGGATTCATGGCCAAAATACTTGTTGCTTTCTTCT
GGGCAACAGATTCTCTTCAGCATTCACTTACCAGCTGTGGGAACTGATTGTTACCATGCA
GTATGGAAATGGGGAGGAATGAACATAGCCTAGCACATGAAATCTGAAATGCACAAGTCT
CATGAAAATTTGATTAAAGTATACGTAACTGTTCGTGTATTGTCCTTCCAATATTACTCA
GGTAAATTCACCTTTGCCTTGGTTTCTGACAATGTTTAGCAATTGAAAGATTTGATCGGT
GTATATGGCAAAGAGCATGTGTCATCCCCGTCATCAATGATTTGGTTTTGGGTACCTATT
GACCTATTGAACGCTTAGGGAAGTAACTTTCCATGTGTTGGGAATGTCAGCTTGGAAGTG
GATGTTGCAAGAGGGATTCTGCTAAGTGGCATCATACATTAGACTTCTTAAACAGTCTCC
TTAAAATTAATATGATTGTATGAACTGAAGGGATACAATTCCCCTCACATCTTGCTCTTT
CCTTTTTAGAGAGGACAGTCTTCAAATTCAAGCTAGGTCTACCCTTATTCCACACAAGAG
CGCTTTGCCCTTGTACCCTCTGCACTTGCAAGTGAGGATTCAAATTCTGAGGCAGTGTTG
GCAGCCCAGGTAAGCCATGGTGCAGGTGAAATTACATTATTGACAGTTGTGTCCTGCCTG
TGTCTTGGTAAATGATGACAACAGAAAGTCAAGAACAGAATGATGACATAAAAATCATGC
TCAATAGGATTACGCTGANGCCCAACCAGNGAGCCAGGGTTACAAGCACTACTTAGTCTC
TTTGANNACCACTTGCGGGACTCATCTGANCTGCTCTGATGANCTTNNNCTCTTTNCCCT
CTNNNNNAANNTNNNCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved