Rattus_norvegicus Locus Mono:567:SNORA67
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Mono:567:SNORA67
Rattus_norvegicus
Mono:567:SNORA67
10
SNORA67
1001..1130
2130
AGAGGAGAAAGAGAAGACGTGGGCGAGGGTGAGGGGGAATATGCCAAGAGAGCCTTACC
AAGTGAGGGGACTGGATTCATTCATTAGTTTCCCCTGCCACCAAGCCTGACGACCCGAGT
TCGATCCCCAGAATACGCGGTTAAACTTGAGAGCTGATCCCCGTGTTGTCCTCTGACCCG
GGGAATTCATCATCACACACCAGTGGTCCCCACCCTCACATCCTGCCCACTGTGTATAAC
CCAGCAGCCCATTGTGTCCTCTTAGCCACTGTTGGGAAATTCGACCCTTACAAAAGGATT
ATCCCAGCCAGACCTGTTAACTTAAATGGTAGAGGGAGATCCAGGAGACCCTCCCCTGAG
TTCTCTAGCTGCCCCTCCCTGGGATAGTCTGCTTCGGGAAGGAACACCCAAACCCTGAAG
CCCTTCTTTGTAAGGAAGCCCAATAAATGTCCCAGATTTTACCTTAGGTTATTATTGGGA
CCTTGGAAATAGCATTTCACTGTGTCTCTGTCTCTCTCCCAATAAATGTAGTATAAACAA
ACAAACAAACAAACAAACAAACAAACATCCCCACCTACGTGGGACCTAGTTGGAGGAAGT
GTGTTTCTGGTGTCAGCCTTACTTCCTGCCTGTACACTGCTTCCTGGTGGGCCTGACTTG
AGAAGCCCCTTTTGCTAGCTTCCCCAGCTCCCCCAGGGGCTAACCCGCTCCAGCTGCCAT
GCTTTCTCCACCATGATGGCCTGTCCCCTCAGGAACAACGGGGAAGCAAACTAACCCTTC
CTTAAGTCTCTCCTCTCGGACATAGTGTCACAACAACAATGGGCACACAGGAGGTGACAC
TTCCCAACAGTGTGCACAAACTCAGCATCACCCACAATCCTCTCATACACTTTTTTCAGA
CACCTCTTCCAAGGCGGGACTCCCCAACAGCCCCCATTCATCTACTGACGACCCTGGTGC
CTGACTTTATTTGAACTATCGCTATTTAAAAAAAGAAAAAAGTCCAAGGTGATTCCCTCT
CCAAAGGGCTGACTGTGTGCCCTTTTCAGGAATGTAGAAACTTGGAAGAAAGCCAGGCAT
GCCCAAGGTCTGGGAACAAGGAATACTTCTTTCCTTTGGCTGCCCACATACATGAAAAAG
AAAGAAAGAAAAAAAAAACCCTACATTTTATTTCATTACCGCGCGTGTATACGTGTGCGG
CTGCACGCACGCCATGGCACACGTGTGAAGGTCAGAGGACGACTGTTCTCTCTGTCCACT
GTGTGAGTCCCACGGGTCAACTCAGGTCATCGGGCTTGGTGGCAGGCACCCTTTCCCACC
GAACCGTCTCCCCGGCCTGCCTTGTTTGTAAAACCTTATTTCCTGCTATTGTTAGACTTA
CCTCAATGGTTATGACAGGAGGCCAGCCCAAACCCTCAGCATAATCCTGACTCCTAGGTG
ACTTCAGTGGTCAGCTTCCTAAACGGTCTGTCTGCCTGCTAAGTCCAGGCCCAGCCCTGA
CGGACCTGTGTGGGTTCGCAGTGCCCTGGCTGCCGGCAGGGGGCGCGGTTCTCCTTACCT
ATCTGCCCATTGTAGCAGCCCCCTAGGAGAACGTGGGAATCCTTAGGGTTGTACTCCAGG
GTGATGAGAGGAGACGATGGCTTCAGGGCAATCTCAGGTCGGTTGGGGTTTTCTAGAATG
AAGAGGGCCAATCAGTTCAAGCCCTTCAAGCAAAGGATGAGAAAAACAGCAGAGGCGTCC
TTCCCCTCCCTCCCTCGGGTCTCTTTTGCCTGAATCTTGGCTAGCGGATTAATTGGGGGG
GGGGGGTGCTGAGGGAGATCGGGATTGGGTAAACGTGTTCGCATATTGAATTCCAGCTCT
AGTCCGTTCCCCAGGTTTGGTGTGAAATGAAATTTTGATCCTAAGGTGTAGAGAGTGGTG
GAGTCCTGCGTGGATGTGTACTTGTGTGCTGTTGACATAGGCGCAGCCTTGCCAAGGGCC
CTGGAGTCTCAGAGCCCCGGAGGACCGGCAAAGCCTCACCGCCACCCCACCCCCCACATC
CCCTGCTGAAGTTTTGGGGTGAGGCTCAGAGAGACATGGCAAAGCCTTCCTCAGTGGACT
GAGAGGGAGTGTTGACAGCGTGCGCAGAGAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved