Rattus_norvegicus Locus Mono:76:SNORA40
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Mono:76:SNORA40
Rattus_norvegicus
Mono:76:SNORA40
8
SNORA40
1001..1128
2128
TATATGTGTGTATGTGTGTATGTGTGTATACATATATATATACATATATGTGTATATAT
ATGTGTGTATGTGTGTATGTGTGTTTATACATATATATATATGCTTACTTTGTTCTTTAA
GGAGATTTATATCTGCTTTATAGTACGCATTGGATTGAGTTAATTTTCACCTGAATAATT
TTCACCAAATTGTGTTTGTTATGCCTAAAATAAACCACTTGTGGCCCAACTCCTGGAATT
TGAACCCACACTGAGTCGTTGTCCGCTGCTGGTTGCTGCTGGCCGTATAAATCACAGCAT
CCCCTGGAGAAGGACACCAAGTGTATTATTACATTTAAGACACAGAGAATCTTCCCATTT
CTGGGTCATCCTTACACTGCCTCCCATCACTAAGGAAATGGGAAGATTCATATTCTTCAG
CCTTTGTCTCCATGATTAGAGCTGTAAGCTCTCCCCAATTGCCAGTTTGCTCCTTTGCTG
GCTGAACACCCTTTATCTTTCCACTGGCCTCCTGGCACTGTCTGGATAACGAGGACCCAA
GGAAGAGAGCAGATACCTTTCTGTGCAGTTCCTTTAGGAAGAGTAGTCAGATGCTGCTCC
AATGTTGACCTTATCCAAATCCTGAGCTTACAAGTTGTTTCTTTTCTTCTGAAGTTCTTA
GGTTGTTGAAAGCTGACAAGTTCAAGGCCATATCACTCCTTTCTAGAATAAAGCAATAGA
ATAAAATACAGACATGGGCGTGATGAGCTGCGTTCAATCTCAAGGATTCCACATGATCTT
AAGCATCTGTGACGGAGAATCCAAGGGGTGCAGACAGACTTCCTGACAGGGGTCCGTCCA
CATATGCATTCCCCATTCCAGCCCTGTCACTCTCTGGATATATTTCACCTTGGTAGAATA
ATTTCACTTAAAAAATTTTATTTGACTCGGGCACATATATCTGTAATCTTAACTTTCAGG
ATGTTGAGGCAGGAGGATTGTAAGTTCAAGACCAGCATGATAGCACTTGTGTTTGTTTTT
GTTCAGCTGTTGGACAAAGGCAGGTTGACAGGTGCAAAAAACAAATCCTCTTTTGCAACC
CAGAACTCATTGTTCAGTATGAGTTTTGATACATACAAGAAGGAATATAAGCACAACGGT
GTTACTGATGAGGCTGTTTCTAGCAATGTTCTGTGTGATTTATCCTATAAAGAAGCACTG
GCATTTCCTTCATAAAGATTAGGATTCTGAGTGTTAGGAATGGACATGAAAGACTCTACA
GAGATGTTGGGTGTCACAAGGGAAACCTACCTTAAAATGGTTTTTAAAGCTAATTGAAGA
AGGGTCCCTAAATTAAAGTAAATTGAAGAAATCCACAAATCTTCTGGCTAAGAACTTAGA
AGTTGCCAATGACTGTTGGAAAAGACAGATAAAAGAGGGCTAAAAATAAAAAGCACAACT
GGATGCCCTTGAGGAAAGGGCTATTTTCAGAGTGCCTGGATGGACAGCAAAGAAATCAAA
CCAACCACTTAAATAAAAATTTATTGACAATAAATAATTTTATACATTAAAAAAGAACCC
TTAAAAAAAAAAAAAAAAGACCAGCATGAACTGGCTACATAACAATTTCTTGTCTCAAAA
CCAGGGCAGCAGAGAAAATGTACGGGGTTGCACTGTGCTACATGCATTAAGGGACACATT
TATTAATTGACCAAGCCAGCTCAGTCAGTCATCAGTGTCTCCAGGGAGGGAGGGAGGATT
GAAAAGAAAAAGACAACTAGACAACACTGTAACATGTCTCCAGCCAGTGCTGAGACAGAA
GAGGGTTTATTTTTTTTCCAGTCTGCTTTTATATCATTCTAGGTACATACAAAGAAAACG
GTCAGTCCTGAGGCATAAACAAAGCAATCAAGGAACAGACAGGACAATAATCAAAGTAAA
TAAACGAGGTAATCAACAAAGTCCCTTGGTCGCTGTGCCAAGGGGTTTATCAGAATGACT
AAGAAACAAGAAATACCATACATTCCTGGGCTGCATTTACCTGAGCCTACTTCCTTGTCC
TAGCCCAATGTCAAATTCCTGCCAAATTCCTAGAAGTGGCCCCACAAGCTCTCCTCAACT
AATCTTATAACCGTTGAATACCCAACTAT
  Untranslated Region
  Coding Sequence
  snoRNA
AC_000076.1
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved