Rattus_norvegicus Locus Tdo2:SNORD113
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Tdo2:SNORD113
Rattus_norvegicus
Tdo2:SNORD113
2
SNORD113
15881..15961
2127
TGTAAAAGGCCCCATAGAAATACAAGCCCTTGATGAATAAAGCCGAAAGAGACCTTGAA
CCAAACCGCAGACAGGTTCATATTGGCCAACCATACTCAACTGACAAGCTTATCATTGAG
AATCAAGAGAAGCCCAGGACATAGGAACCCAGCGCTAGGAAACAGCCTCTGCCGCAGAAC
TGACCACTGTCAACATCCATTCTATATGGGGGAACCTCCCAGTACTGGGTGAAATCGCCT
CTTGCTCTGCCTACCTTGTAGGAGCTGATAAACTGAGTCACATTTGCTTTCTGTCATAGC
CGTTATGTGAAGAGATGTCTGTGCGTCCTCAGTTCCAGTGTCAGAAGGAAGAGCTGGAGG
TCACTCACAATAATGCCATGTGCTATCTATCTCCTTGCCATCTCACCCACATTTGTATAG
AGCTTTTGCAGACTTTCTGTCTTGGTCCTTAAAAACGGTAAACACAATTATCTCTTTGTC
CTTTTGTACTAAATAAACCTATTAAAATGAAAATAGAAAGGAAAGAAGGAAGAAAGGAAG
GAAGGAAGGAAGGAAGGAAGGGAGGGAGGGAGGGAGGGAGGGAGTAGGGCGACATTTTGC
ATCACTGGTGATGCTGGTAGTATACAATTAATACCACTGGTGAATGCTGGTGTTAAAGTT
GGGTGGATAATGATAATATCATGGATTCACTTCATTTCTAATCCAAAGTGAGTGTTGAAA
CCGACCCTGTACAGGCCTGTCATATCATTTCACATTGCTAGGTAACATTTCTTAAAACCT
AAGAATTGATTTCCAGTAATCATTTTATCTTCTTCCCTTTATCATTTTATCATTACCCTT
CCTGCCCCAGTCTGTAAGTGTGACAGTCTGTACTTAATCCTTCAGTAAAGGATTAAAAAG
CTGAACTGGAGAAATCAATCAAATATTCAGTTCTTGCTGCTCTTACAAAGGTCCCAGGTT
CAACATCGTGGACACTGAACACATGTGATACACATACAGGAAATCAGGCTTATAAATATT
TACTTTAAAAAATATTAGAATCTCCAACTGCATGCCAGAGTAACGGAGAGACTTTGACAG
CCCAGGTTATCACAGTGCCTGCTGTTGCCACTCAGCTCTCCTATATGTTTTTCCACTGGA
GTTATGAGCTGCCTGTCCTTCTGTCCTGTGGTATTCACAACAAACTTTCCTTCTGCAGTG
TGCACTTGGGCGGTTCTTGGAAGAGTGAGGAGACAGCCTGTCAGCCTCTGCTCATTAACC
TAAGGACCATGTGACCAGTGAGGTGGCCATCTTGTGATTTGGTCTGCATTATTTGTTGGA
AAAATGCCACAGGAAGATCACACTGGGATTTAGAAGTTTCTGGCTAATACTTAGCCAGGT
AGCCTTTTGTGGCCAGATTGGTCTACAAAGAGAAACAGCATTTTGGAAAAGTGAAATACC
TTTGTAACCTAACATGCAATTGGTTCAATAAAGACTTCAAATTTCTTTCTCTGAAAAAAA
AATATTAGAAAGCCAATGGCCTATGATCTAAATTTAGATATGGAAGAGTTGTTACACCCA
GATTTAACTCTGGACTACCTGTCTTCTAAGGTTATAGGTACAAGACAATTGAATGGAGGT
GCCTACCACTTACCTCTCCCATTAAAAAAAAGAAGAAGCATTTTGAAGGGCGTGGCAGTA
GGAAAATACCAGAAATGTCCAAGAGAGGCAGGAATCTTGTAGGATTCAGAAACCTGAGGT
AACTGGAAGACAAAGGCCCAGGGGTTGCAGCAGTGTCTCCATAGCCTGGGCAGATCCTAG
GTGTTGGTTTCTCGGTCCTCACAGATTTGCAGCCCACCATGGTAAGTAACTGAAAATCTG
CACAAGTGCCTTGCTTTGAAATAGGTTCTCACATCCTCTCTCAGTGACCTGCCAAGGTGT
CATAACCAAGCACTTACTCTGGAAACAGCCATTGTCACCACCAAGATGTTCTCAGGGTCA
GAAAGTGCTGTCTATTTTCATCTTTGGGACTCACAATTATTCTACTGCACTGAACCGGGG
GAAACAAACTTATGAAGGCAACATGACATGGTACAGACGAATAACTATGACTCAATCCCC
ATGGGTGCCCTGCAATAAAGAGGGTAGT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1581, 4056..4146, 5566..5645, 6872..6929, 8031..8142, 10811..10918, 11909..12095, 13293..13420, 15052..15122, 17529..17619, 18513..18618, 18844..18917
1428..1581, 4056..4146, 5566..5645, 6872..6929, 8031..8142, 10811..10918, 11909..12095, 13293..13420, 15052..15122, 17529..17619, 18513..18618, 18844..18878
AC_000070
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved