Rattus_norvegicus Locus Mono:380:SNORA2
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Mono:380:SNORA2
Rattus_norvegicus
Mono:380:SNORA2
19
SNORA2
1001..1143
2143
TACATACAGCATGCCGTGTCATCAGCCCCACATTTCCAGAACATCCCCCTAAGTGTACC
TATCAGTGTCCCATGGGAACCCTGACCTCCCTGTTTTGCAGTTGGGGCCACCTCTTGGCA
GTGGCCCATTCCCTGAGGAGGGCAGAATGCCAGTCTAACTGTCAAAACTAGGGACAGCCC
CACCGCATACCCACCGTTAAAAGGCAGCCGTGGTTGTCTCTCCAGCAGCTCCCAGAGCCG
CCCGCCAGCACCCAGGCCCTTCATCAGCTGGGAGTAGAATGAACTCAGACCTGAGGGCAA
GAAGAGTCTATCATCAGCTGATGAGAAAGGCCACAGGCCCTCCTGCCTGGGGAATCCTGG
AGACAGCAACCACAGCTGTCACTGTGTAACCTGTCACTCTCTCTGAAGAAGCTGAGGCCT
TAGCTGCTCTACCTCTTACCCTAGTGCTCCTACAGCCTCTCTTTCTCAGAGTCCTATTAA
GGAAAATGACCACACTGCTCACCAGTGACAAGTCACAGCACTGCAAGGAAAGCCACCTCC
TCCTCAGACAGCACTTCAAGTGCAGCATGGGAGCCTTCCCCATGTGAACTGAAATCCCTA
CAGGAAAGCTCCTACAAGGGCCTTCAGAGACAGGAGAATCTTAAATGTGCACAAATAAGA
GAAAGATGCCAGCCAGGAAAGGCTGCATGCTTTACTGATTCCAACCCCATGACACTTGAA
AACTTCCAAACAATACAGATAGTAGAAAGCAACCTGCCAGGGGTAGAAGAATTAATAGGT
AGACACGGAAAAGTGCAGGGCAACCAGGGCAACTCTCTTGTGATGTTACAATGGTGAATT
TAGGGCAATACACATTTGTCCAGACCATACTGTGTGTGTGTGTGTGTGTGTGTGTAGACT
CAGCAACTGTGTAACAATGGCCGCTCTGGTGAAAAGGGTACTAATCCTGACACTGGGGTG
GGACAATCACTGAAAATGCAACAACGTTGCTTTTTAAAAAGAATTCTAAGACTGAAGACC
AGCAGTTGTACTGTAGCTGTTGGTTTCAAGCAGACGCGCGACGCCTAAAGAACTGTCTTC
CTGTGGTTTGTTGGCTATTCTGGACTTCAGTAGAGAATGACTATTCCATTTGGAGGAAAC
AACCCCTTGTTCTGTCTGGTTTGACAGCTTCAGTAATGACTGATTCTTAGGAACAGCAGA
GTACTGCTGGGAAAAGTACTGGGAAAAAACTAATTACTTAAAACAAACAAACAAACAAAA
AAAGATCTAAGGCCCATGTAAATTCCAGGCCAATGGGGTCTATATAGTGAGTTCCAGGAC
AGCTTTTAAAAAGGTCCAAAGGTGAGTGTGGTGACCCACACTTGTAATCCTAGTACTCAG
GACACGGAGGCATGAGATTTCAAAGGCAGCCTGTGCTATACAATAAAACTCTCGATTAAA
ACAAAAATACTTGGGCTGGAGAGATGGCTCAGCGGTTAAGAGCACTGACTGCTCTTCCAG
AGGTCCTGAGTTCAAAGTCCAGTAACCACATGGTGGCTCACAACCATCTGTAAAGAGATC
TGATGCCCTCTTCTGGTGTGTCTGAAGACAGCTACAGTGTACTTAATACAATAAATAAAT
CTTTTAAAAAACACTTTATAGTTATTAAAACATGTAAATATATATGTGTATAGAACATAT
AAATGCTACTCTCAGCTTTTCCCAGAGAAGCATCTCCTTGTAGTGAATAGCAGTGAATAG
AGAGGCTCAGCCATGACCCCAAAAATTGGCAAGATATCCATTGAGAGCTCACCCCTAACA
GGGCTTTTATAGCACCTCCACTAAGGCTCAGGAATATTTGCCAAAGAATGGATCAAAAGG
ATGTCAGAACAAGAAGACAGGAGGAGGGGCTGTGGAATGCTTTCTTCCAAGCATCGAAAG
CCTTTGCCATCAGGAGCTCACCCACCGGAGCCATGGTTGCAGACACTGGACCCCATAAGA
CTGGCCCTGCAATGGGCAAGAAAGGGGCCGACAGGGCCCTGCCATTCTCTGCTGAACTTC
TGGCAACCCATAGCGTCTGGGAAAGGGAGGGTCACTGTCTTCATCTGTTCCCACTGTTAT
CCAGAGCCACACGACAATCCAGGTTAAACTCAGTGGGACTCAAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved