Rattus_norvegicus Locus Mono:202:SNORA44
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Mono:202:SNORA44
Rattus_norvegicus
Mono:202:SNORA44
4
SNORA44
1001..1127
2127
TGTAAAAGGCCCCATAGAAATACAAGCCCTTGATGAATAAAGCCGAAAGAGACCTTGAA
CCAAACCGCAGACAGGTTCATATTGGCCAACCATACTCAACTGACAAGCTTATCATTGAG
AATCAAGAGAAGCCCAGGACATAGGAACCCAGCGCTAGGAAACAGCCTCTGCCGCAGAAC
TGACCACTGTCAACATCCATTCTATATGGGGGAACCTCCCAGTACTGGGTGAAATCGCCT
CTTGCTCTGCCTACCTTGTAGGAGCTGATAAACTGAGTCACATTTGCTTTCTGTCATAGC
CGTTATGTGAAGAGATGTCTGTGCGTCCTCAGTTCCAGTGTCAGAAGGAAGAGCTGGAGG
TCACTCACAATAATGCCATGTGCTATCTATCTCCTTGCCATCTCACCCACATTTGTATAG
AGCTTTTGCAGACTTTCTGTCTTGGTCCTTAAAAACGGTAAACACAATTATCTCTTTGTC
CTTTTGTACTAAATAAACCTATTAAAATGAAAATAGAAAGGAAAGAAGGAAGAAAGGAAG
GAAGGAAGGAAGGAAGGAAGGGAGGGAGGGAGGGAGGGAGGGAGTAGGGCGACATTTTGC
ATCACTGGTGATGCTGGTAGTATACAATTAATACCACTGGTGAATGCTGGTGTTAAAGTT
GGGTGGATAATGATAATATCATGGATTCACTTCATTTCTAATCCAAAGTGAGTGTTGAAA
CCGACCCTGTACAGGCCTGTCATATCATTTCACATTGCTAGGTAACATTTCTTAAAACCT
AAGAATTGATTTCCAGTAATCATTTTATCTTCTTCCCTTTATCATTTTATCATTACCCTT
CCTGCCCCAGTCTGTAAGTGTGACAGTCTGTACTTAATCCTTCAGTAAAGGATTAAAAAG
CTGAACTGGAGAAATCAATCAAATATTCAGTTCTTGCTGCTCTTACAAAGGTCCCAGGTT
CAACATCGTGGACACTGAACACATGTGATACACATACAGGAAATCAGGCTTATAAATATT
TACTTTAAAAAATATTAGAATCTCCAACTGCATGCCAGAGTAACGGAGAGACTTTGACAG
CCCAGGTTATCACAGTGCCTGCTGTTGCCACTCAGCTCTCCTATATGTTTTTCCACTGGA
GTTATGAGCTGCCTGTCCTTCTGTCCTGTGGTATTCACAACAAACTTTCCTTCTGCAGTG
TGCACTTGGGCGGTTCTTGGAAGAGTGAGGAGACAGCCTGTCAGCCTCTGCTCATTAACC
TAAGGACCATGTGACCAGTGAGGTGGCCATCTTGTGATTTGGTCTGCATTATTTGTTGGA
AAAATGCCACAGGAAGATCACACTGGGATTTAGAAGTTTCTGGCTAATACTTAGCCAGGT
AGCCTTTTGTGGCCAGATTGGTCTACAAAGAGAAACAGCATTTTGGAAAAGTGAAATACC
TTTGTAACCTAACATGCAATTGGTTCAATAAAGACTTCAAATTTCTTTCTCTGAAAAAAA
AATATTAGAAAGCCAATGGCCTATGATCTAAATTTAGATATGGAAGAGTTGTTACACCCA
GATTTAACTCTGGACTACCTGTCTTCTAAGGTTATAGGTACAAGACAATTGAATGGAGGT
GCCTACCACTTACCTCTCCCATTAAAAAAAAGAAGAAGCATTTTGAAGGGCGTGGCAGTA
GGAAAATACCAGAAATGTCCAAGAGAGGCAGGAATCTTGTAGGATTCAGAAACCTGAGGT
AACTGGAAGACAAAGGCCCAGGGGTTGCAGCAGTGTCTCCATAGCCTGGGCAGATCCTAG
GTGTTGGTTTCTCGGTCCTCACAGATTTGCAGCCCACCATGGTAAGTAACTGAAAATCTG
CACAAGTGCCTTGCTTTGAAATAGGTTCTCACATCCTCTCTCAGTGACCTGCCAAGGTGT
CATAACCAAGCACTTACTCTGGAAACAGCCATTGTCACCACCAAGATGTTCTCAGGGTCA
GAAAGTGCTGTCTATTTTCATCTTTGGGACTCACAATTATTCTACTGCACTGAACCGGGG
GAAACAAACTTATGAAGGCAACATGACATGGTACAGACGAATAACTATGACTCAATCCCC
ATGGGTGCCCTGCAATAAAGAGGGTAGT
  Untranslated Region
  Coding Sequence
  snoRNA
AC_000072
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved