Rattus_norvegicus Locus Poly:6:SNORA17
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Poly:6:SNORA17
Rattus_norvegicus
Poly:6:SNORA17
15
SNORA17, SNORA17
1001..1129, 2642..2770
3770
CTGGAAGAAACAAGGAGTTCAAACACAAAAGACCACTCAATTACTAACTCTTCATATAC
TCATGAAAGTCTTACTTTTGTTTTCTCAAATTGTCTGAGTTCATTGCAAGGCACATGAGG
CAGACCCCTCCATCATCAGTAAAGGCAATAATCACACCAACATGACAGCCAGTCAAGCTG
CCTTTTTATCCCTTACAATTCATCACACTCTCTCTGTACCACCCTACTATATAACCCAGA
AAACAACTTATATATTTGTCTTTTAGCACAAGACAGAAACTTCTAATTACATCAAACATT
TCACTCTAATGATCAATCACTTTTATGCTTTCCTCAAAACCATCTGACTCTCACCCATTA
GATAAGACCTTTTGAACAGAACTTAACCCAAACCTGCATTGTATGTCAGCAAAATAATAC
CACCTCCACTGTATGATTACCTCGTATTCCTACTCACCAAGTTATAAAGGCTTGAATTAT
AAAATCTAAAACAATGTTCAAAGGTATAAAATGCAAGTATAAGCCTGAGAATATAAAAGC
TACCCCACGAGAGTCTGTAAGATGGTCTAAGGTAGTGTCTTAAGGTCTAAGGATGTGGAA
GCTTAAGTAAGTTGTGAGGGTTTATTTATGAATTTGAAATATATAAAAAGGTGTTTAAGA
TTTCTTTTTCTCTGTCTATGCTATTGTTTGACTTTACTTTAACACAAAGATATAAATCTA
CTGCTCTTTCTACAATATATATTTCAGTAAGATTACAAAAAATGTAACAATTTTATCCCT
TTTTATAAATCTAAGAATTCTCATAAATGGACTTAATCTACCTCACACAGATCAAATGAA
CTCCAAATTGACTTCTGTCAATCAACAGCCTAAAATTTCTCCACCTATTTCTGAGCATGG
GATCTCTCTCCCTTTTCTTGGTCTTCTCGCCTTAACTACCAGGACCATGGGTGTGGAAAT
TTCATATGTACACCAAAGATTTTTTAAAAAGTTTCCTGCTTGCTGCCCTTAGAGCCATTG
TAGATGTGGCTGCTCTTTCACATGTACATCAGTAGGTGGCAGAGTGGACAGGGGCTATGT
CCACACTCAGTGTTCTGACCTATGAATATCTAAATGATGAATGTAACATTCCCTACAGAA
AGGAAGCCTAAGACTACCTCCAGTACAGGACCAAGTCTCCAAACCGAGAGTTGGCCTGAG
ATGAACACCAGTCTGGCAACATGCAGGCCTAGAAGGGGGCAGATGACCCATGTGTGGCAC
CATAATGCATGGGCAGGGTACAGCACTCCTGAGACTACTCCTGGATAACCCCAGACACTC
AGAGACCATGGGCACTACTAAGAAAAACAAGTAAGTAGTGGAGAAATGAAAGAAAAGAGA
AACAGAAAGATGTGAGCACAATGAAGAAAAGCAGAACTGAAGGCTCAAGGTAGAGAGAAA
CAGCCTGTTGTAGATACCTGGTGATGCCACCTGATGAGCACAGAACCTGTGCTGCCACTG
GGGGGGCACATCTGGGTCCATGGCCCTGCAGTAGCAGGGTTCTGTTACCATCAAAGGCCA
GGTGGATATCCTTGGTCTGGGCTGCTACCCAGGGATATTTCGTTGTGTGAAGACTGTGCA
GAGATGGTCCTACCCCTCACCTGGGCATGATAGGAGAACTGGCCCTAGAGGCATGAGAGC
AGGAGAGCAGACCTCACCCTCCTGCTGCAGTAGTCAGGAGAGCTGAGCTGAACACAATTA
CAGGAGTTGTGAGGGACCTGGCCCTGAGGATGCAAGTGTGGAAGATCTGGCTCTATCACT
CATTTTTCTGTGGTGACATGAATGAATGAAGGATACCTTTCTTCCCCCTCACCCCTCACC
ACTTGTGGCAGGTGCAAGAACCAGCTCTGGGGTCATTAGAGTAGGAGAGGTAGCCCTCCC
TATCCCCTAACCTGCTACAGCACTCTGGAAAGCAAGCCCTGTACTTCACCTGAGCAGCAC
AGGAGAGCTAGGCCTGGATATATGATTGCAGGAGAGCCAAGCACAGGACTTGAGTACAGA
TGAGCTGGCTCTGCCTTTTGGCTTCTGGACAGTGGTGCTGGTGAGGGAGAGACACATTTT
CCTCTCCCTTAACCCTCTCATTTGTGGCAGACCAAAGAGCTGGCCATATCCCTCATTGGC
AGCACCCTGAGCAGACCCTTTCCCTCAACTGGGCAGAAGGGTAAAGCTGCCCCTGATTGC
AGGGTTTGCAAGTGAGCTGGTCTGAAGGGCATGAAAGCTGAGAGCCAGTATGCTGACCAT
GTTGGATGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTCAGTAAGATTACAAAAA
ATGTAACAATTTTATCCCTTTTTATAAATCTAAGAATTCTCATAAATGGACTTAATCTAC
CTCACACAGATCAAATGAACTCCAAATTGACTTCTGTCAATCAACAGCCNTAAAATTTCT
CCACNCTATTTCTGAGCATGGGATCTCTCTCCCTTTTCTTGGTCTTCTCGCCTTAACTAC
CAGGACCATGGGTGTGGAAATTTCATATGTACACCAAAGATTTTTTAAAAAGTTTCCTGC
TTGCTGCCCTTAGAGCCATTGTAGATGTGGCTGCTCTTTCACATGTACATCAGTAGGTGG
CAGAGTGGACAGGGGCTATGTCCACACTCAGTGTTCTGACCTATGAATATCTAAATGATG
AATGTAACATTCCCTACAGAAAGGAAGCCTAAGACTACCTCCAGTACAGGACCAAGTCTC
CAAACCGAGAGTTGGCCTGAGATGAACACCAGTCTGGCAACATGCAGGCCTAGAAGGGGG
CAGATGACCCATGTGTGGCACCATAATGCATGGGCAGGGTACAGCACTCCTGAGACTACT
CCTGGATAACCCCAGACACTCAGAGACCATGGGCACTACTAAGAAAAACAAGTAAGTAGT
GGAGAAATGAAAGAAAAGAGAAACAGAAAGATGTGAGCACAATGAAGAAAAGCAGAACTG
AAGGCTCAAGGTAGAGAGAAACAGCCTGTTGTAGATACCTGGTGATGCCACCTGATGAGC
ACAGAACCTGTGCTGCCACTGGGGGGGCACATCTGGGTCCATGGCCCTGCAGTAGCAGGG
TTCTGTTACCATCAAAGGCCAGGTGGATATCCTTGGTCTGGGCTGCTACCCAGGGATATT
TCGTTGTGTGAAGACTGTGCAGAGATGGTCCTACCCCTCACCTGGGCATGATAGGAGAAC
TGGCCCTAGAGGCATGAGAGCAGGAGAGCAGACCTCACCCTCCTGCTGCAGTAGTCAGGA
GAGCTGAGCTGAACACAATTACAGGAGTTGTGAGGGACCTGGCCCTNNNGATGCAAGTGT
GGAANATCTGGCTCTATCACTCATTTTTCTGTGGTGACATGAATGAATGAAGGATACCTT
TCTTCCCCCTCACCCCTCACCACTTGTGGCAGGTGCAAGAACCAGCTCTGGGGTCATTAG
AGTAGGAGAGGTAGCCCTCCCTATCCCCTAACCTGCTACAGCACTCTGGAAAGCAAGCCC
TGTACTTCACCTGAGCAGCACAGGAGAGCTAGGCCTGGATATATGATTGCAGGAGAGCCA
AGCACAGGACTTGAGTACAGATGAGCTGGCTCTGCCTTTTGGCTTCTGGACAGTGGTGCT
GGTGAGGGAGAGACACATTTTCCTCTCCCTTAACCCTCTCATTTGTGGCAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved