Rattus_norvegicus Locus Poly:7:SNORD74
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Poly:7:SNORD74
Rattus_norvegicus
Poly:7:SNORD74
13
SNORD74, SNORD75, SNORD24, SNORD44, SNORD78, SNORD79, SNORD47, SNORD81
1001..1081, 1486..1547, 1697..1778, 2309..2369, 2603..2668, 2987..3061, 3648..3725, 3872..3948
4948
AGGAGGTGGCACGGATGCCAGGAAGAGAGAGGAGCAGAGCCCTCGGCAAGGGAGTTTCG
GGCGCACAGGTGAGGCTCGGGAGGGGAAAGGGGGCGGTGCCCCGGACCTCGGTAGAGGGC
GGCGGAGGCTGCGGGGGTGGGGGTGTGTCTGGGTGTGTCCCCGCCGCGCGGGGTCCTGAG
GGAGGGGCTCGCGAAGGGGGCGGGCCCACGAGCTCTGCAGCCCAGAGCCAAAGGAGTGGA
AGGTCGCCGAGTGCTTGGAGGGAGGTGGGGCGGCGACTGAGCGCTCCAGGAGCTGGCTGC
AACCAAGACGCGGCCAAGGAGCGTCTGGTATGGGCTAATGGGGCGGGGGTGCGGGACCCG
AGCTCAGTCGAGGAGCAGCACCTACCTCCGGGGGTGGAAATGGGCCGGAATGGGCCGGAA
CACCGTCCCGGAAGTGAAACCCCCCGCCCCCTCCTCCGGAGCGGGCGACGTGCCGGAAGG
AAATCAGTCACCCTCACACCGCCCCTCCCCCAGCTCTTTCCTTGCAGGAGCCCCTTCCTC
TCAGCCTTCACTCCTCAGGGAGGCAGGGGGCGGGCCTGACGTGCCTGAGGCAACTCCGCC
CTTCAGGCTCTCAGGGGCGTGGCCAGCTGAAAAATATGAGGGCGGGAAGGAGGTGGGTCT
TGAGGAGGAGTCTGAGGGCGTGCAAAGGGCGGGGCTTGGATGGACGCAATGGGCGGTCGT
GCGTCTTGACGTCACGGAGACCTTATATACTCGACTCAGCCACCATATCGGCCTTTCGGA
GCTGTGAGGCGAAGCTGAGCAGGTATGCGATATCTGTCCGTTACGGTTTTAGGCCTTGTG
GGAATGAAGCTCCCTAAGCTGGTGGAATTCCGGTGCCAAAAGGAGAGCTTAGTTTAAGGC
ACGAGCTGGACGCTTTGGAAGATTTGCTTTCTGCGTATGTGACATAAAATAGCATTGGAT
TTTTAACCTGGAAACAATACAATACAATAGTGACTCAGCAAGTGACTCTTGCAATGATGA
AGGTTATGTTGGTAGGGACAACTGACCTTGTTGATGAATACCAACAATTCTGATGGCAGA
GCATGCTGAGTCAGGTCGAGCTGCCTTTTGTACTCACGTGCTATTTTTCGGTGCACCGTA
CGGCTAGGGTTGAATGCAAAGTCCTGCGGTATTAGATAACCGTGACGTCGAAGGCGTTTG
CTAGAAACTGCCACAATGTAGACCTTAGTAGAAAAGGGAATAAGTTTCCACTTGGGAAGG
GCCTGGTATGGAGAATTAAGTGTGATTGCTAGACAAACGCATCTTACAGTGCCTTTGTGA
AGGAAGCTCGTATGACACATTTTTACCGGGGTAGAACTTAAGAAAAAGACATTAAGTGAT
AAATCCATTCGTAGGAATGGCCCTGTGGACCTCTGTGATGGGACATCTGGTGGAATCTCA
CAGGCAGGTAAGTCAATAATGAATCTCCGAAACATAATGAATTAAAAGCCCATGATGGTA
TGAGAGTAGTGGACAGAAGGGATTTCTGAAAAACACTGTTCTGAGGCTTTAATATAAAGT
GCTGGGGGAAAGTAAGTTCAGTGAAGGAGGGGACTGACTCTTCACATCTTTTCTTTCTAG
TTCTGTGGCAAAGATGGATGAAAGCTAAGGTTAGTATGAAAATGGCCCTAGTGAGAGAAG
TTCGATGAAAAAGATAGTGCCACAATGATGACATCATTTGCTACTCTTGACAGTTGGGGT
GACGATAGCTATAGACCACCATTAATCATAACTGAGGCACAAAGAAAGATGATTGGGGGG
CACTTACAGAGTAAGCAGTATTTACATAAAGACTTTCTTCCCCAGGACTCATGAGGAAGC
TGGATAACTGAACAAAGCCATGTAAGCAGGCTTTTTGGTATGCATGTGGTCCCATTACAA
GGAATACCCAATAAATAGCAAATGCACACTGCCATTCACAAGCAATTGCAGAGAATGGGT
GGGGGATGTGAAACTAAAGAGCTTTGTAGCTGCCTGAGGAGGTGGGTTCTCTATATCCGT
GGGAGCTAGTGATCCCCCACAGGTCTTAGCTGGTGCCATGATTGTGATCTTAGGCCAGAT
TTGATGTCCCCCACATGGCCGAGTCCGCCATGGATGCAACAGGGCAGCTTTATTTGCTGT
TGCAGGTACAAGAATGGGAAGCCAGAAAATGGGATGGTAAGTGAATCTAAAGGATTGTAG
TAATAGAGGCCAAATATGGCTTGGCATTACACTTTTTGAAAAGTGCTTGGGCCACATGCA
GTGTCCTAGCCATATCTTTGTGAACACAGCCTACATGATGACAAACAAATGCTGACTAAT
GTGAAGATCTTAATTAGCTCTATCTGATGTTGGGCTCCACCTGGCTTTTGTGGGGAGAGT
TGAATTTTTTGACTGCACTAACAGTTGTAATTCTTTCAGGTGGAGTTTGAATCAGGTGGA
CAGTTCTAAAAGTAAGTAGTGAAAAACAGTTGCTGTAGGTCAGTACAAAGTGGCATGAAG
AAATTTTTAAATTCAGAGTCCAGCATGTATTGTCTTCTGATGCTTGAATTAGTTGTATTC
TTGACAACACTTAAACGGGGTTTTTGTAATGATGTTGATCAAATGTCTGAGCTGAAAATA
ACTTGTAGACAATTTTTAACACTGAAGAACCCTGTGGCAGGCTACTAAGCATAGTTGGGT
CACATGCAGCATATTTGTAAGAGGTATTTTCTTTTAATTCTAGCTACTGTGGTTGCATGC
TTTCATTGGGATGGCTTGCTTGGGTAAGAAGCCATTGGGGGTCTTGAATTCAAGATGTAT
TCTATCCAGTAGTCATTTGCAGTATTCCTGTATAACATTTAACTTTTGAACATGCATGTG
CTACCATGGGTACTAAATGGTGCCTTCAATTTTTTTTCAGGTACAAATGATTTCGTATAA
AGGTAAGCATTGTAAACTTGGTGTTTATGATGTGAAAAAGGGTACTGTTAGTGATGATCA
ATTAAGTTAAAACAGATGGGAATCTCTCTGAACAACATTGGAGATTGATTGTTAAGCTGA
AACAGTATTTAAGAACATGGGTAAATAACACGTTATAAATACATGTTTCTAAACAGCATA
TTCCTGCAGGTACCACATGTGGGTCCCTTTAACTGAAGGCATGGCAAGCTCCACACAAGG
TGAGTCTGAGGTGTGCATGTGTTGAAGGTACTTGGAACAGTTTGCCAGTAAGCCGATACT
GTGATGATAACATAGTTCAGCAGACGTGACTCTGGTGAACAATCATGTCTTTCGCTCCTA
TCTGATGTATCTGGCTGTTATGTGTTCCATGAATTGTATAGTATTAGGAAGCATATGGAA
AGCTGGTCCTAGTGATTGAGGCCAAATCCACGGTTTCATGTCCTGTGCCACTTAGTGAAA
AAATACAGTTCCCTGGGTATGGTGAGCAACCAGTTTTTCTTAGGCCTCTTAGCAAGGGAA
TTGAGATGAGCCCCATAGAGACTAGTGAACGGAAGACCCAAAGAATAGTTTAAATGTAAT
GGAGGGTGAATGATTGCACTAATGAAGTTTTTAAATTTCCAAACAGGTCCTTCATTTCTG
AATTTCAAGGTAAGTCATCTTGTTTTTCTAGATTGTAATATGGCTTGTAACCAGTGATGT
GATGATTCTGCCAAATGATACAAAGTGATATCACCTTTACAACCGTTCCATTTTATTTCT
GAGGTTACTCTGGTAACATGTTAGCTTGAACCATTCTAAGCCAGATGAGTAAGTTTTTGT
TTTCTTAGGGCTCCTCTGACAAGTGGACAGTGCAGTGGGTGCACCTTTTCCAGAGGTGAG
AAACTAAGACTGCTTTTAACCATGACGTACTACAGAATACATGATGATCTCACTCCAACT
TGAACTCTCTCACTGATTACTTGATGAAAGTAAAAGATCTGATGTTCTGTATTTTAATTA
ACAATTACCATCTATTTAAGTTAAATAGAAATGTGCCTAACTGCTACCTCTGTTGCAGGT
GACTGGATGGATGCTTGAACAGAAGATTTGCCAAATAGACATTGTGCTGTCAAGAATTTT
ACCATTAAAAGTGCATTATTGTAGCATCTGAAGTGTGATTTGTGCATTTTGTTCTGATGA
GCATATTGTGGGGACTTCTTCACATTAGAGACATAGGCTTAAATCTGTCAGCTGAAGGTG
GTGGGTATGCTTGCCCTTTTAGAAGGTTACAGTTTCTTGGGGATGTTGCTCATTCTATGG
TCTGTTGGGTGCAGTTCCTGAGATGACTTAATTTTGTGACAAGGCAAGTTTGGGATGCAT
GAGAAACCACACTGGGTGTTGTGGTCCCAAAGGGAATTGAGCTGAAACACTTTAAATTTC
AGTTACTCCCTTTAACACTGATCCTCATGTGGGCATTGGCTCTAGGCAAGATTTGTAGTG
GGTATTTGGAACACTTAAAAACTGGGATGGAAGGGGTTGGGGATTTAGCTCAGTGGTAGA
GCGCTTGCCTAGGAAGCGCAAGGCCCTGGGTTCGGTCCCCAGCTCCGAAAAAAAGAACCA
AAAAAAAAAAAACTGGGATGAAATCCCCAGAAGATTTTTCTCATTTGTGTGATGTCTGTA
TAGAGAGCAGGACAGCAGGACAGCTAGCAAGCTGTATAGAATCCAGCTACCAAATCTAGG
TCTAGTCATGGCTTCCTGCAAGCTGTTTATTGATCTCAAACCCAGAGATCTGCCCACTTC
TGCCTCCAAGATTTTGGACCATATTAAGACACCCGTGGTTTAATTTACTTCAGAACACAA
GATAAGCTAAAAGCAGTTGCAGAACTAGAATCAAGTCTAGACCACATCCGCCTTTAAGAG
GTGTACCACCACAGCCTGCCTAACCTACTTTTATAGGATCCAAAGGGGTAGAGATAGCTT
CCAAACAGGAAGTTTGCCTCCTTTAGTAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved