Rattus_norvegicus Locus Mono:412:SNORA2
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Mono:412:SNORA2
Rattus_norvegicus
Mono:412:SNORA2
17
SNORA2
1001..1137
2137
TCATTAATAACTTCTATAATATACACATGTTATGCACTCTGCCTGGTACTACAGACTTC
TATATTTCCCTGTACTAGTTATGAATTGTGGGCAGAATTTCCCATGAGACTTGGGCAAAA
TCTGTATTTTCTCCAACTATAAAAACAATTTAATCACATTTCTATTAATACCTGCTAGTA
AGAAGCAGGCAGCTTGTCAAGCCAGGATTTAGCCCAAAATTCCTATGGAGCCCACGTTAG
AGAGAATGTGAGTATCCTGTAAGACTTATTAGAGCATTATATCTTTATATTACCCATCAG
TTAACTTCTCTACCTGGAACTTCAGACCTCCACTTACTTGCAACTTTTACACTATACCTC
TGTTATGCACTCTACATGGTGCTGCAAACTTTTTTTCTACCTTAGTTCTGAATCATGGGT
GAAATTCCCCCACGAAACTTGGACAAACTCTGAATATAAATCTGTTCTAAAAGCAAATAA
ACCAGTCTTTGAATTAAGCCATACTCTAGGCTCTTTGACCTAGAACAGCCTGTTTCTTTT
CATAGCAGGTGACCTAGAGTCTGAGCAGAATCTCTCTCTGTGTTTCTTTCTTTTTTTTAA
TTTTTTATTAGATATATTTCTTTACTTACATTTCAAACATTATTTCCCTTCCAAGTTTCC
TGTCCATAAGCCCCCATTCCCTCCCCTTCCCCTCCCATACGAGTATACCCCTATATATCC
CCCTTATTGCCCCCCATATTCCCCTGCACTGGGGGTCCAACCTTGGCAGGACCAAGGGCT
TCCCCTTCCCTAGTGCCCTAACAAGGCTATTCTCTGCTACATATGCAGTTGGAGCCCTGG
GTCAGTCCATGAATAGTCTTTCAACAGTGGTTTAGTCCCTGGGAGCTCTGGTTGGTTGGC
ATTGTTGTTTTTATCAGGTTTTGCCAAAAGTAATCTACAGATTCAATGCAATCCCCATCA
AAATTCCCTCTGTGTTTCTTTTGTTTAAGATTCCAGGGCTTTTGGCCCTGAATCAAGGCC
AGCAGTTTGCTGAAGCTGTTGGTTTCAAGCAGGTCCCTAAATAAATGTCTTTCTATGGTC
TGTTGGCCATTCCAGAAATTTAAAAATGTAATGGTCAATTCATTAGAAACAAACATCTGG
CTGGATATGGTACCCTGCTCTGTGATTATAGCACTTGGGAGGGTAAGGCAAGAGAATTGA
GAATCTGAGACCTGCCTGGGCCTCAGCAAAATCCTGTCTAGGGTAGGTGAAGTGGGGGGG
GGGGGGGCAGGGAGCCAAAGAAACAGCCATGTTGTTTGTGACAGATGTGTATGGCTGACG
GTCTTAGTGGGGTTCCATAGTTTGTGTATGATACTAATGCTTTACTGATTTAGCTTTGTT
CATTAAGTTATATGTTAAATCTGTCACCAAGAAAAAAAGGATTACTGTGGGTTTTCTGCC
CAGAACATGAGTCTGTACTGTGAATTTTAGGCAGTACTATTGTTAGTGCCCTAACTTGTA
TGCTTTAAACTTACTCAAATTAGAAACGTGGAAAAAAATGGGGTTTCTCCCCAGGATAAA
AAAAAAAAAGATTCCAGGGCTTGAACCACCACGTGACTCTGACTCGTCATGGCACCACCC
CTCTCTCACTTAGAAAAAACCTCCCACTTAGGAAATAAAACTCTAGAGTTCTTTGTATAT
ATTGGATATTAGCCCTCTATCAGATATAGGATTGGTAAAGATCTTTTCCCAATCCCTTGG
TTGCTGTTTTGTCCTATTGACAGTGTCCTTTTCATTACTGAAGCTTTGAAATTTTATGAA
GTACCATTATCGATTCTTGATCTTAGAGCATAAGTCATTGGTGTTCTGTTTAGAAATTTT
TCCCTGTGCCTATTTGTTCAAGGCTCTTCTATCAGTTTCAGTGCACCTGGTTTTATGTGG
AGGTTTTTGATCCACTTGGACTTGAGCTTTGTACAAGGTGATAAGAATGGATTGATTCTA
CATGCTGACCTCCAGTTGAACCAGTACCATTTGTTGAAAATGCTGTCTTTTTTTTCCACT
GAAGGGTTTTAGCTCCTTTGTCAAAGACCAAGTGATCAGAGGTGTGTGGGTTCATTTCTG
GGTCTTCAATTCTATTCCATTGATCTACCTGCTTGTCT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved