Rattus_norvegicus Locus Mono:591:SNORA44
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Mono:591:SNORA44
Rattus_norvegicus
Mono:591:SNORA44
1
SNORA44
1001..1125
2125
TAGACTATGCTTCCTTCTAAATAAGCAGGAAATCTCAGAGTAATGGGGATAAAATACAA
ACCACAAGGTTCAAAAGAAAGGACTTCTAGAAATAGCTCATTCTTATAGGCTTGGCATTG
TGAGCCAAGCAGAGGAGCTGTGCAGTGCAGGGAGGGGAGGAAGAGAGAAGAGAAAAGAAG
AGGAGAGGAGAGGGGAAGAGTGGAGAGGCGAGAGGAAAGGAGAGGAGAGGGAGAAGAGGG
GAAAGGAAGGGAGGAGAGGGGAGGGGAGAAGGGAAGAGAGAGCTGAGCCAAGTCGAGTCA
AGACACAAGAAGAAATCATATAATCTCTTGTCCCACCCTCCATTAGTAGAGGCTGTGGAC
AGATGGTCTAAGCAAACCTCAATATCCAACCACACTTGATCCCCTGGAAGCCCACTTCTT
CTGAAGGTTGTTCATGCCATTTGTCTGTATTTCATTCTTTCTCACTCCCCCTGAATACTT
CTGAAATATAGTCAGCTCCTCTGCCAATGCTCTGACATCAAGCCAGAGGGCAGGAACTGA
AGCAGAGGCCATGGAGGAGTGCTGCTTCTGTGCTTCCTCTCCATGGCTTACACAGCCTGC
TTTTATAGAACCTAGGACCACATGCTCAGGGATGGCTCTGCCCACAGTGGGTTGAGCCTC
CCATACCAATCATTAATCAAGAAAACATTCCCCACAAACTCACCTACAGACCAACCTGAT
AGTCATTTTCTCAAGACTCCTTATCAGATGGCCCTAGCTTATTATCACGCTGACAAGAAA
CTAACCAGTAAGTGCCAAAGCCACACGCCATTCACCCTTCACCCGATTACCTGCATTTCC
TGTATCTATACCTGGGCTGCTGGACAAATTCACATAGTCTTAAAGGGGGTGGAGCACCAA
AAATCCATGGCCTATCATCAGATTCCTGAAAATCTTTCAATGAGCCCCAAACAAATTATT
TCTCACAACTCTTTCCCTAACCAATGGTGGCCTCAAAGACCGAGTTTCTTCAACTCTTTT
TTTTCTTTTAAAGATTTGTCTCCAACTGCATGCCAGAGTAACGGAGAGACTTTGACAGCC
CAGGTCATCACAGTGCCTGCTGTTGCCACTCAGCTCTCCTATGTTTTTCCACTGGAGTTA
TGAGCTGTCTGTCCTTCTGTCCTGTGGTATTCACAACAAACTTTCCTTCTGCAGTGTGCA
CTTGGGCGGTTCTTGGAAGAGTGAGGAGACAGCCTGTCAGCCTCTGCTCATTAAGCTAAG
GACCATGTGACCAGTGAGGTGGCCATCATGTAATTTGGTCTGCATTATTTGTTGGAAAAA
TGCCACAAGAAGATCACACTGGGATTTAGAAGTTTCTGGCTAATACTTAGCCAGGTAGCC
TTTTGTGGCCAGATTGGTCTACAAAGAGAAACAGCATTTGGAAAAGTGAAATACCTTTGT
AACCTAACATGCAATTGGTTCAATAAAGACTTTTCAAATTAAAAAAAAAAAAAGATTTGT
TTATTTATTTTAGGAGTACACTGTCGCTGTCTTCAGACATACCAGAAGAGGGCATCAGAT
CTCATTACAGATGGTTGTGAGCCACCATGTGGTTGCTGGGAATTGAACTCAGGACCTCTG
GAAGAGCAGTCAGTGCTCTTAACCACTGAGCCATCTCTCCAGCCCCAGTTCTTCAACTCT
GAAGACACAATCTCACCCCTACTTGACAAAGAAAATTAAAATGAGGCAACTTCTCTACAT
TTGTGCTTATATGTAACCTATTAAAATAATAGTATTCACTTCCAAGGTCTTAAAAAGCCT
TCCTCTTACACCTAATCCTACATGTTTCACTAATTTCTTTCTCCCCCTATGACTCTTTAA
ACATCACATAATATGAACATATTTATAATCATATAATCCTCAGTGTCAACTGACTGGATT
TAGGGTCACTTAGGAGACATAGTTCTGGTTGTATCTATGAAGTCTGTGAATGTGCTTCCT
AGAAAGGTTAACTAAAGAGGGAATGGCCACCATTAAATTGACTGATATCATCCCATAAGC
TGGAAGACTGAATAAAAAGATTTTAGACAATCAGAAAAACAGATAGCAGAAGCATTCCCT
TGGCTAGTCTGATGACCCACACGTAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved