Rattus_norvegicus Locus Mono:361:SNORD45
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Mono:361:SNORD45
Rattus_norvegicus
Mono:361:SNORD45
2
SNORD45
1001..1080
2080
AAATCAACCCCCGGCCTCTTTGAGTGCTAGGAAAGCTCTTTACAAACTGAGTGACATGG
GGTCCTTCAGGCAGACGCATAGCCTGCTGCACCGTGACCGCGGAGTCCTTCAGGCAGGAG
TGCGGCCGGCTAAATCGTGACCGCGGGGTCCTTCGGGCGGAGCGTGGCCGGCTAGGTAGG
GCGTGGGCTGCCGGGCGGGCGCCTGTGCGCAGGCGCGCAGACCCTGACTTTCCGTGCTCC
CGCGCTCTTCAGTCTTTCGGCGGTCGGACATGGTGAGAGCGACATCGCTTTGGTGCGCGG
AAGTTGGGGAGGCCTGGGCGGTGGGTCAAGCTGCTCCGCATCGTGGGCTGGCGCAGCACG
GGGAGCGGGCGGGCATGCAAGGCTAGCATTCTTCTTGCATTCTTCTTGTGAGCTCTCAGC
AATGCTCCTGCCTCGGCCTTCTGAGGCCGGTCTTAGACCGCTCCTTGAGCAATGGCTCAG
CGTTTTCTGCAGTTCTCGAGGGTTGTGATGTTATCCGCGGCCCGTAGGCGAGCCTCTCTG
GATTGAGCCGCCTTTTTTTTTTTTCCCTTTGCATCGGAGACTTGTGTGTGCCTGTTTTTT
TCAGGGTTCAATGATCATTTACGAATATTGTTTCAAAGTTAAATATTCTAATTGGGATGG
AAGAAGGCCGGCCTTGGCCCACGCCTTTTAATCGTATCACTCCTGAAGCAGTAGCAGGCA
GCCTGGTCTACACGGGGAGTTCCAGACCACACAGGGCTTCATAGCCGAGACTCTGAACAA
AATAGAAAAATAACTTATTTGGCAGTGGATTTGCTTTGACCTACTTAATGGGTGATGGCG
AATATCTTAGATCCGAAGGTGAAATTTGGAGCTAATGGGCCTGATCGTTTAGTAAAGGAG
ATAATATTTGAGGACTGTTGAACAGTGCACTGAAGCTTCAAATTCACCGATCGAGAGTGT
GTATTGCACTTGGTCGGCAAAAAGGTGAGCGGCAGAATTCGGGTCAATGATGAGCTGGCA
TGTATTCTGAATCTAAAGTTGATTAATAACCACTTTAGCTCTAGAATTACTCTGAGACCC
GAAAAAAAAAGTGCCGTCATCTGGTCATACGAGTCTGGGCTGTCAAGTTTTCAGGATGTC
GAAAGGAAAACGTAATGATCCAGTCTCTGTTTTTCTTCGAAGGGCACACAGCAGAAGGAC
GTCACCATCAAGTCAGATGCGCCTGACACCCTGCTGCTCGAGAAGCATGCTGATTATATC
GCCTCGTACGGCTCAAAGAAAGATGATTATGTGTGTATGAGTTTCTTGTTAGTTTAATAC
TAATGGACAGGCCTGTTTCTTAAAGCGTTGTCTGTTGGCAGAGGCCTGATTTAAAGTCCA
TTAGGATAGATGGGCCTGGTATACTAGAGGTTGATACTGGATAGCATTAGCCTTGCATAC
CGGTACACAAAGGGCCAGAATACAGGGATGCAGGTAGAAGGGGTTTACTCCTTTCTGTCT
GGGGTATAACCTTGAAGGTCAATGATGTGTTGGCATGTATTATCTGAATTTGCTGATGTG
TCCTAACATTTGAGCTCTAGAATTACGCTGAGACCTTGAAAAGGTTTTACCTAAACAGTA
TAATAGGGAGGTTACCACACCCCTGTGATAATCTCCAGCAAGGGGTAGAGCTGGAAACCC
CGGGCTTTGTGGGGAGACCCTCTCCAAAGAGGAATCACATGGGTAATCAGACCCTTATTT
TGGGAGGGGGGGAATCATAGGCCTAAATGGTCCTTATGTCAACTGTCCGCCTGGCCCTTT
AGGCGTTTGGTTTGGCTTGGCAGCACACCAATGACACCTGTACCTGAGTGAACGCTTGTG
AAATGATGCTTGATTTGGTTTCCATCTCCAGCACCATTTATCTCTCCGTATTCATAGACC
TTGTAAAATGCAGTAATTGGTGTTTGGTAGACTGAAGGAGTGAATGTTGCCTACTAAATT
CACCTGAAGTTGGCACTTGGAAACTATTAAAGTTTGTTCTCAATCTTCCTGATGCTGCAA
CCCTGTCGTACCATACAGTTCTGCATGTTGTGGTGAGCCCC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved