Rattus_norvegicus Locus Mono:333:SNORD22
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Mono:333:SNORD22
Rattus_norvegicus
Mono:333:SNORD22
2
SNORD22
1001..1129
2129
GGTTTGGCAGCAGGGAACTGTGGGCCGGGATCAGTGAGGTTCGTGCTGTTTCATAATTT
TAAAGTGAGTTTACACGCACTAGTTGTTTGTATTCAGCTATTCCATAAGCAGGCTGAGTT
AGATGGTGAGGCAGAGCTAACTCTCTCACATCCTTCATACTCAAGGTAAGTCTAGTCCTT
TTCTCTTTGTCACCATCATGGCATTGTAGTAAGTTCTTCCTGTTAATACTCTTACCAAAG
GGAAAAATATAATTGTTTAGCTCACGTATCCATTTAGTTGTATTGTCAACTCTAAGATAG
GTTCATTTCCCCATAGTGTGAATTGTTCCACTGTACTAAGCAGAAGAGGTGAGTCTTATA
AAGAGAGGAAGCAAAGAGAAGCAGAACAAAAGGTAGTTGTTTTTTCTTTAAGTCACTTTG
GTTTTGTTGTTGCTAGTCGGGTTTTTAACTGTGTTGCCACAAATTTAGAATTCAGTGGTC
TAAAACTTGCAATCTTCCTATACTGTCTACCTAGTCCTTGGACTAACTGCGAGGTATCAC
ACTCAGCTTCTAAGTCACTTTTGTTATAAGGTAGAGACACTGAGAAATAAATTATTAGTT
ATCATTAGGTTGCTGTGTGTTCATGAGAGAGGGGACAGAGAGAAGGGCAGGGGAGAGAGA
AAACTATTGCTGTGCCTATTTAAACTGACTTGTTTGGGAAATGTAGCTGTTATCTCTCTA
ATTCTAACTCCTGAGATCAGATAACCCAGCCAAATTTAACTTGATTCATGGAACTCTAAC
ATGACTGGCTCAACTTTGTTTCAGTCTTGCCTCTTATAGTCTAGGAAAGGATTTTATCCA
CAATTAGTAAATTTTACTAGCACCACAAGGGCATACATGAGAAGAGCATACTTGCATTTC
TATGTATCTTAGTACAAGAACTGACTCATTCAGTGGCCAACTGCTTCAGTCTGATGTGGC
TTTGGGTGCAGAATACAAACCCATGTCTCTGAAATCCTCTTTTCTTGGGAACACTGAATC
ATGAGTCAAATGTGCAGCGCTTTGACTCTAGTAAGACAGGGTGGTGAACCCAGTGGGGCT
GGCTGGAGGAAAAGAGGAAGTTTTGTTCCAGAAGGAACTGTCTGAGGGATCATTTGTGTG
CATAGAAAAGGAAGAATTGTCACTTTGATTAAAAAGGAAACAAGGTGGTTTATCTGTTTT
CCAGGTCTGAGGAAAGGGATGGTGTGCGTTAAAGGAACTGAAATTAAAGATTTGATTATC
CAGGCCAATGGTACAGCAAACTTGGGAATTCATGGAATGAAGCCTGTTGATTTTTTATGG
GTTTTTATTATCTGAGCAGTATCTGGCACTTGAAATGGAATGGTTGGTCTCTTCTGTACT
GCTGGAACAGATTATGTTCATTTCATTACAAGAGACTACATTTATCTCCTTCCCCCCTCC
CATACCTCCTCCCTCCTGTCCTGGGACCACTTTTTAAGAAATCTTTGTAATTCCAAGTTT
ACCTTCCTTGCTTACCTCATTGTTAAACTGATCCTTCCACTTGTTATTTGTGCTGTGTCC
TTTTTGTTCTGGTAATAAATGCTTTTTATGTCAAAAAAAAAAAAAAAGACAGGGTGATAG
CTGCATGGATGAAGTAGGAGGACCAGAGTTGTATCTTTAAAACTCATTAAAAACCATGTG
AGTGTGGTATAACTCCACGTTTTGTAATTTCAGGACATGCTGGGCAGCTAGACTAGCTCA
TGTCCTAAGCTTGGTTAATACAAAAGATAGGAAATGACTCTGAATGACTCCCATTGTCCG
CCTTGGGTTTTCACAAGCTTTTTCACATATGCACCCATGTACGCCCCACAACAGAATCAT
GTGTATACATAAATTCACATCACAGACATATGCAAAAATAAATAAGAATGATAGAAATGA
TACAGAGAATAATTCTCATAATCAGTTGAAGTGGAAAGTGTCTCTTACACCAGGATTTTT
CGGAAGCTTTGATAATATCCCCTTGTACTGAAAAACCTGTGACTCTTGGTAAGAGGACCA
ATAGCGACTCTAGAAGCTGGCAGCAACTTGGTGATACCTCTGGAATGCACCATGACAATG
CAGACATGCTTGTCCCAATCCTTTTGGCTT
  Untranslated Region
  Coding Sequence
  snoRNA
NC_005101
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved