Rattus_norvegicus Locus Mono:461:SNORA31
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Mono:461:SNORA31
Rattus_norvegicus
Mono:461:SNORA31
15
SNORA31
1001..1130
2130
AGGGTTGTATAACCTTAACTGTGGGATCAGAAAACATGGCTCTAGCTGTCCTGGAACAC
CCTGAGGCCCAGCTACCCCTGCTTTCTGAGGTTAAAGGCATACAGCACCACAGTGGGCAA
GGAGCTGGTATTTAAAATGGTAGACATTGCTTTCTTTTCATTCAGACTGGGTTATCTGTA
GACCAGGGGGGCCTTGAACCCAGAGGTTACCTGTCAATGCAGCTTAGGTGCTGGGACTAA
AAGTGCGTGCCAACATATGGTAGCATGTGTTACTTTTGAGTACCAAAGATTTTTCTTTCC
AAATGTTGGCTAGGGTTATTCTGGATCTCCTTTTTATGTTTGTGTGTATGTGACAGTCTA
ATTGTAGGTTTTCTTCTTAAGTTTTTTATTGGTGAAAACATGAATCCAGATGGCATGGTT
GCTCTACTGGACTACCGTGAAGATGGTGTGACTCCATTCATGATTTTCTTTAAGGATGGC
TTAGAGATGGAAAAATGTGTAAGTATCTGTTAAATTAGAAAAGATAGGAGTGTGGTGATT
CTTTGCCATCTGCAGGTAGTAGGCCTTGTAGATTGTGAGATTTGGGCTCTTTATCCTGTG
GGATCTGACAAGGTTAGTGCCTTGAACATGAAAAGGTTCTGGAGATAGACGGGCTTGCTT
GTGTAGAGTGCTTAGGGTCGTGTGAGTTTGACACTAGCCTGGTATAAACTCATGCAGAAT
GAGTGAAATGGGGCTAGTGTCTCTGCCCCACCGTAGTTCAAGTCCATTTCAACAGGATGT
TTCTTTTTAGTGTTTACTAACTTCAATAAGAAGGAATACAACAGTGTCTGTTATATAAGG
GACTGGTAGAGTCAGGGTAAAACAAAAGTTCCTCGTCCTGGATTTTGGAGGCTTGTTTTG
CAAGCCAAGTAGGTGAGCTTAGAACGGACTAGAGAGTGGGTGGGCACCAGGACAGTGGGG
TGGAGCAAAGTATAGAGTCAGCAGACTCCGTGAGGGGTGTTCTGCATCCACTGATAGACC
TCGAACAGTTTATGGTTGTTCTTCTGGTTTGCACTAGGATGCAAAAGGAAACTCTCCCTT
CGCTTCCTGCCTGCCTTTGTGGCAGTCCAGATTGAATTGGGGAGTACATCTCTACACTAA
GAAAGTGACAACACTGAGGCTGAGGGTAGTTATTAATGCCATCTCTTTGTTTTCCAGTAA
CAAATTGGATCTATCGCCTGTCACCATAATTGGCTGCTGCTTACCATCCATACAACACCA
GGACTTAGGACAAATGGGACTGATATCATCTTGAGCTTTTATTTTGACCGTGATTTATTT
GGAGTGGAGGCATTGTTTTTTTTTTTTTTTAAAGAAAAAAAAACATGTCATGTGGGTTGT
CTAAAAATAAAGTGCATTTAAATTCACTCAAGAACTCCTCTTTGCTATAATTGTGTCTGA
GAAGCTAGAGCCCAGTTGAGCATCCTAGGAAGCTAAACCTCTAGAGTTAATGCTACAGTG
GGGACTCCACGGGACTGGAAAGTGCAGACACAAGAGTCTCAGTTGCACTGAAGGAGAGAT
GGGAAGTGGACCCTCACTCATCACCTTCAGTGGAAGAAAGAGCTCACCAAACGCACAAAA
GACCACCTAGCGGGGAACGAATACTATCTGCTTCTTTCAGAAGTAGAACTACGTACGTCT
CCTGGACTAATGTCAGATTCCTGGTAACCAGAGTTAGCGGTTAACAAGCTGGCCTGCACT
ACCTTAGAGTTGTACAGACATGGCACAGACCACGAGTGCTGGCTGTTTTCAGGTTGGGGT
TAGTCGGTACCTGACTGGATGCGATGTGAGGAAGCCAGCAGCCATGCTTCATGGCGTGAC
GTTAGCCCACGAGACCTGTATGGATTGGATCTTGAGAAACAGAACAGCATACTATCTTCT
GTAGAAGTAACTGTTTATATGCCTGATAGAATAGTTGCCTAAAAATAGATTTTGAACTTG
TGAAATCCCGTACTTGCTGTTGCTAATGAATCTCCTAAAGCTAAAACTAAACTTCATTTG
CCATCTAAGGTTTCTCCAGCAATGGAAGTCTAAAAATGAGCTAAGTTTAAGGAGGTGCTA
GCACCCCTCTGTGATGTGAAGTTCAGATAAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved