Rattus_norvegicus Locus Mono:347:SNORD47
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Mono:347:SNORD47
Rattus_norvegicus
Mono:347:SNORD47
2
SNORD47
1001..1077
2077
AATTTAGGTCTATACTAACATATATGAAGATTTTTAAAATTGTGTGTATGTGATCACAA
CTGTAGATGGCCACGGAGGCCAGAAGCACTGTGTCTTCTGTAGCTGGAGTTACAGGAGGT
TGTGAACCACCCAGTGTGGGTGCTGGGATCCAAATTCAGGTCTTCTGCCAGAGCAGTACA
TGCTGTTAAACTCCAGCCTCCGTCATCACATTTTTTTTAAAAGATGTATTTATTTCTATG
AGTACACTGTAGCTGTCTTCAGACACACCAGAAGAGGGCATCGGATCCCATTACAGGTGA
TTGTGAGCCACCATGTGGTTGCTAGGATTTGAACTCAGGGCCTCTAGAAGAACAGTCAGT
GCTCTTAACCACTGAGCCTTCTCTCCAGCCTCCATTATCACATTTCAAAACATGAGAAAA
TAAAATCAGATCAGGACTCTCCAAGCAACTTTCCAACAAAAACATTTAAGAGTAAAGGAA
AAGCACGGAGAGTCAACAGAATGATTTCATGAGAAAAGAGCTCTAAGAACCCTGGTGCAC
AATAACTAAGTTACTTAGCATGCTAAATCCACTCCCTTAGCCTGCTATGTGTACTGGCTG
GTTTGTGTATCAACTTGTCACAAGCTGGAGTTATCACAAAGAAAGAAGCCACCCTTGAGG
AAATGCCTCCATGAGATCCAGCTGTAAGGCATTTTCTCAATTAGTGATCTCAAGAGTGGG
AGGGTCAATCCATTGTGGGTGGTACTACCCTGGGCTGGTAGTCTGGGTTCTATAAGAAAA
CAAGCTGAGCAAGCCACGAGAGCAAAGCAGTAAGAAACATCCCTCCATGGTCTCTGCATC
AGCTCCTGCTTCCTGACCTGCTTGAGTTCCAGTCCTGACTTTCTTTGGTGATGAACAGCA
ATGTGGAAGTGTAAGCTGAATAAACCCTTTTCTCCCCAACTTGCTTCTTGGTCATGATGT
TTGTGCAGGAACAGACACCCTGGCTAAGATACTGTTTTTGCAACCAACAATCCAATGATT
CTGCCAAATGATACAAGTGATATCACCTTTGAAACCAGTCCATTTTATTTCTGAGGTTAC
TCTGGTAACATATTACCTTTAACCATTCTAAGCCAGATGAGTAAGTTTTTGTTTTCTTAG
GGCTCCTCTGACAAGTGGACAATGCAGTGGGTGCACCTTTTCCAGAGGTGCCTGGATGGA
TGCTCAAATAGAAGATTTGCCAGATAGACATTGTGCTGTCAAGAATTTACCATTAAAGTG
CATTATGTAGCAAAAAAAAAAGATACTGTTTTTGTGACAGATTATAGTTGATTTTTACAC
ATAAACTAAAAAAAAAAAATAAGTGATATACTAAACCTTACTTTCTTTGTATTTGGGATA
GGGTCTCTGTAGGTAGCCCAGGCTGGCCTCACAGTCTCCCTCTTTCTGCTTCTGCCTCTC
AAGTGCTAGGATTACACAGTGTACCGCCACGCCCTACTTAAAGCTTTGGATAAGTTTTAA
AGCACACAGTGTAGTTCTGTTAACTGTAAGCCCAATGTCCTATCGCGGACACATAGAACA
TATTTCCCTTGAGTCACTGAGGCAATGTACCCATTCAATGGCAGTTGGCACTTTCTGCTC
CAGTAGCCCCAGGCAGACTCCCTCCCTGTACTACTCTGTTGGTACAAGTTTCCTTTTGTT
AGACATCTCCTTTAAGTGCAATTTTGCAACATATGTTTCCCTACAAATAGTTCATTTCAC
TTCCCCGGTTTATCCATGTTGTTGCATGTTGCAGAATTTCTTTCTTCACTAAGGCTAAGT
AATAGACCACATTTTCCACTACCCACTGGTGAGCATTTAAGTCGTTCGCATGCCTTGGCT
GTGATTTGGTGCAGCAATCAACAGAATAATGGCGATATTGCTCTGACATATTGATTTCAG
TGGGGAGCAGCTTATATCACGAGACACGGGAACATTGGAATCATGTGGTACTTTCTCCTT
TTTTAACTACCTCCATATTGTTTTTCATAGAGTTTTCACCATTTTTAATTCCTGCCAACT
GCATAAGAGCATTCCAGTTTCTGTAATTGATATTCAGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved