Rattus_norvegicus Locus Mono:406:SNORA7
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Mono:406:SNORA7
Rattus_norvegicus
Mono:406:SNORA7
17
SNORA7
1001..1118
2118
CCCAACCTGCTAAGCTCAATCATCTGCCCTCATTAAGCCAAAAAAAAAAAAAGTGTGTT
ATCTAAGCAGCAAAAGTATTTCCGTCTAAGACTGAACTGCCAGATTACAAAAAATGACAA
AATATTTCCTTATTTTTCTATTTGTCCTGTTTTCTTCCATCCTTAGATGACAATAAGTTA
AAAAAACTGAAACAAAGACAGGATTTTACTGATGTAATCTTTCACCTAATCCTATGTGAG
CATCAGTGTTGAGGCTCAGGGTGAAAAGTCTGTGTTGAGCAAGGCTGCCAGCATGACCTT
GCTCTCCATATACAGATGGCTAAGGTAGAAGCCACAGTATTGTCTTCCAGTCTCCATATA
TCTGTGGTTGCCTAAAAACACATCACCACATTCTACACACACCCAACTGTAAAAAATAAT
TAAAATAAATCTCACTGCACTTACATTTTCCTACATCTGCAAATAATTTCCTTAGGAGGC
AGCAGTTCTAGAGGAAGTACCAATAGCATTACTCACAGTGTATGAATTAGCATGGACTGA
CAAATAATTATACATACACATTGTACAACAAGCTGCGTTGTGAGATATGCAGTTGATTGT
TGATTACTGTACATTATTACACTTCTAGAGATAGATGAATAGGATCCTTTGGGTATACAC
CTAAGGTATTTAATGTTCTTTCTATTTCCACCTATTAAGGATTTTAACGTTAATGTTATT
AAAATGTGTTGAGTAAACAGTACACATAGAGTGCACATCTTCTTTTCTTTATTTTTTTTT
TCGGAGCTAGGGACCGAACCCTGGGCCTTGCGATTGCTAGGCATGCACTCTACCACGGAG
ATAAATCCCCAACCCTGAGTGCACATCTTCTATCCCTGGACTTGTACTCCGAAGGCTGAC
ATGTGAGAATCAAGAATGAAATTATAACCCAGACTAATGACTGACACCAAAGCCAGGCTG
CATAACAAACAACATCTCAAAGGAATTTGTGAAAATATAAAAAAATCAAGTATTCTCTGC
CAGCTTTGGAAGAAGGAGGGAGGACAAGTCTAGCAGAGGTACCCATTCCATTCCAAGTTT
GCTCAGTAGCTGGTGATTGGAAGACACTCTGCATCATCACTCAAGAAAAAAAGAACAAAA
ACAAACAAACAAACAAACAAACAAAAAAACCAAAAGTGATCCCATCATGCTTTCACCAGC
AACATTACTGGAAATGTATAATCACAAAACCTGTTATTTGAATAAATGATGGACCACATA
GAAAATGAGTATTCAACTCACTTCAATGCAGAAGAAAAAATACCAATCTCAAAGTAAAGT
GGAATTAATGAACAGAAGTCACAGAAGGAACTCAAGGACAGCCTAATAAATATCTGTAAA
TGGATTTGAAACACACAAAACAAACTTTAATATCTATACCAAGTGTTTGAAATTACAAAC
CAGAAACCTAACTGGTGATCTCTACTACAACACTTTCATGAACATGGGAAATAATTTACT
TCCCTCAAGGATATGATGAAGAAGAGATGAAACAGGATGCTTTTCTTGAAACTGAAAATA
TCTGTGATGTCCACAGTCTATAGCCAAGTCAATAACATGGATAGGGTTTGTCTCTTGTGT
AAGTTTTACTATTTTCTGACATCAAGATGACATAAAAACACTTTAAAATATTTACATCCC
TGGAAACATGGCCAAGTAATAAAAGCTCATTCCCAGAAACAAGATCAGGTTTTGACATTT
TACTGTGACTCCTGATATAAAAAGATACAAGTTTAGTTTTCTTGGAAATCTGCATTCACA
TGCACAGACCTACACAAAGACACAGACAAATCTCATAATTAAATTAAAAGAAATTGATAA
ACAAAGAAAATATTACTCATGATGTTCTTCTTGTATAACCCAGGGGCTGAGGCATCTGAA
GGCTTACCCACAGCATTTTTATCATCATGAATTGGCTCATGTAACAGAATGCAATCATAT
AGCCTTGAAGACAGAGAAATCAATTCTTCTCAGTTGGTAGTGTCATTTGGGGAGATTTAG
GAAATGTTCCCCTGCTGGAGAAAATATGTCACTGGGAGTAGACTTGTGAGGTTAAATCTT
CATACCATGTCTAGATGCC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved