Rattus_norvegicus Locus Poly:15:SNORD115
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Poly:15:SNORD115
Rattus_norvegicus
Poly:15:SNORD115
1
SNORD115, SNORD115
1001..1078, 2840..2917
3917
TTTCATGTAACTCTCAGGCCACAGGGAACCTAGCCAGAAGGGGAGATTGAAGTTGAAGT
CGTGGCTTTTGCTACCAATTCCCTTCCATGTATACTCACACTGATTCATCCTTGATCTTA
CTAAAGTTGACTTCAGTATTCATCAGAAAAAAAAAGCTATCAAGGAGATATTTTCTGGAG
CTCTTGGGACAGACGAACGTGATGTCAATGGGATACTTGCAAACACCAACTGATGTAGTC
ACACAAATTTTGGTCACATTCTCAGTTTGATCACATGGCAATCACTGGGTGCTAACAATC
AGGGATTCATGGCCAAAATACTTGTTGCTTTCTTCTTTGCAACGGATTCTCTTCACCATT
CACTAACCAGCTGTGGGAACTGAATGTTACCATGCAGTACGGAAATGGGCAGGAATGAGC
ATAGCTCGGCACATAAAATTTGAAATGCACAAGTCTCTTGAAAATTTGATTAACGTATAT
GTAACTGTTCGTGAATTGTTCTCCCCATATTACTCAGGGAACTTCACCTTTGCCTTGGTT
TCTCAGGATGTTTAGCAATTGAAAGATTTGATTGGTGTAACTGATCCAGAGCATGTGTCA
TCCCCTTCATCAATGATTTGGTTTTGGGTACCTATTGACCTAATGATCTCTTAGAGAAGT
AACTTCCCAGGGTGTTGGGAATGTCAGCATGGAAGTGGGACTGAATAAGTGATTCTACTC
AGTGGCATCATACTTTAGCCTTCTTATACAGTCTGCTTTAAATTAACATGATTGTATGAA
ATGAAGGGATACAATTACGAAAACATCTTGCTCTTTCCTTTTTAGAGAGGACAGACTTTA
AATTCAAGCTTGGTCTCTCCTTATTCCACAAAAGAGCGCTGTGCCCTTGTATCCTCTGCA
CTTGCAAGTGAGGATTCAAATTCTGAGGCAGTGTTGGCAGCCCAGGTAAGCCATGGTGCA
GGTGAAATTAAATTAGTGACAGTTGTGTCCTGCCTGTGCCTGGGTCAATGATGACTACAG
AAAGTCAAGAACAGGATGATGACATAAAAATCATGCTCAATAGGATTACGCTGAGGCCCA
ACCAGGGAGCCAGGATTACAAGCACTACTTTGTCTCTTTGAGGACAACTTGTGGGACTCA
TCTGAGCTGCTCTGTTGCCCTTGTGCTCTTTCCCCTCTGTGGGAACCTGGACAATCTTAG
TGCAAGTGTGCTGGCAAACACTGCCTGCCAACTAGCACCTAGTCTCATAATCTGCTTGTG
TGCAAGTCTGCAACACCAACCCTGTCATCATTACCCTCTCTGCTCTGATGTCTTGCAGTC
ACCTGGCATCACCCCTGCTGTCCAGTGGATCACTATTCCCAGGTGAGTGAAATGATCACG
ATTAATGGATTGAACTTCTTATAAGATATTCCTCAGTCTTTTGACCAATAATTACAGCTC
ATCAAAGTTTTCTTAATTATAAATAATGCAATACAAGTCAGAAATAAATTTCACTTCTCA
GTATGTTCTGTCGCTTTGAACTGCACAATTAAAAATGTAGAGAAATTCCTTTCTACCTGT
AGTTCATACAGCCATAAAATTGTATTTCTTGGACGAGATCCTAGATGATACAATCTACAC
AAAAGGAGTGATCTGGAATATGAATATACCTTTTGAATTTCGAGAAATTTCAGTCCACAC
ACAGGCTCACAAATCCAAGCTGGTGCATGGTGATCGATTTCCAATGGCAATGGGAACCCA
GGAATAAGAATTTAGTTTAGAGATGTAGAAATTGGTGATAAATTTTCTGCATCAAAAGAC
ACTCCAAGAATTATTCCCCCAAGAGAGCTTGGCAAAATTTTTCATGTAACTCTCATGCCA
CAGGGAACCTAGCCAGTACGGGAGATTGAAGTTGAAGGTGTGGCTTTGGCTACCAATTCC
CTTCCATGTGTACTCACACTGCTTCATCCTTGATCTTACTAAAGTTTACTTCAGTATTCA
TCAGAAAACAAATGCTATCAACGAGATGGTTTTTGGAACTGTTGGGAGAGAAGAACGTGA
TGTCAATGGGATACTTGCAAACACCAACTTATCTAGTCACACAAATTTTGGTCACATTCT
CAGTTTGATCACATGGCAATCACTGAGGCTAACAATCAGGGATTCATGGCCAAAATACAT
GTCGCTTTACTTCTGGGCAAAAGATTCTCTTCAGCATTCACATACCAGCTGTGGGAACTG
ATTGTTACCATGCAGTAAGGAAATGGGGAGTAATGAACACAGCCTAGCACATAAAATTTG
AAACGCACAAGTCTCATGAAAATTTGATTAACGTATATGTAACTGTTCATGTATTGTCCT
CCCCATATTACCCAAGGAACTTCACTTTTGTCTTGGTTTCTGACAATGTTTAGCAATTGA
AAGATTTGATCAGTGTAAGTGATCAAGAGCCTGTGTGATCCCCTTCCTCAAGGGTTCGGT
TTTGGGTAACTATTGACCTTAATGATCTCTTAGTGAAGTAACTTTCCATGTAATGCGAAT
GTCAGCATGGAAGTGGAAGTTGCAAGACTGATTCGGCTCAGTGGCATCATACATTAGACT
TATTAAACAGTCTCCTTAAAATTAACAAGATTGTATGAGCTGAAGGGATACAATTGCCGT
CATATCTTGCTCTTTCCTTTTTAGAGAGGACGGTCTTCAAATTCAAGCTAGGTCTCCCCT
TATTCAACACAAGAGTGCTGTGCCCTTGTATCCTCTGCACTTGCAAGTGAGGATTCAATT
TCTGAGGCAGTGTTGGCAGCCCAGGTAAGCCATGGTGCAGGTGAAATTGCATTATTGACA
GTTGTGTCCTGCCTGTGTCTTGGTCAATGATGACAACAGAAAGTCAAGAACAGAATGATG
ACATAAAAATCATGCTCAATAGGATTACGCTGAGGCCCAACCAGGGAGCCAGGTTTACAA
GCACTACTTTGTCTATTTGTGGACCACTTGCGGGACTCATCTGAGCTGCTCTGATGGCCT
TGTGCTCTTTCTCATCTGTGGGAACCTGGACAATCTTAGTGCAACTGTGCTGGCAAACAC
TGCCTGCCAACTAGCACCTAGTCTCATAATCTGCTTGTGTGCAAGTCTGCAACACCATCC
CAGTCATCATTACCCTCTCTGCTCTGATGTCTTGCAGTCACCAGGCATCACCCCTGCGGT
CCAGTGGATCACTATTCCCAGGTGAGTGAAAAGATCACGATTAATCGATTGAATTTCTTA
TAAGATATTCCTCAGATTTTGACTAATAAATTCAGCCCATCAAAGGTTTTTTAATTAAAA
ATAATGCAATACCAGTCAGAAATGAATTTCACTTCTCAGTATGTTCTGTCCCTTTGAACT
GCACAATTAAAAATGTAGAGAAATTCCTTTATACCTGTAGTTCATACTGCCATAAAATTG
AATTTCTTGGAAGAGATCCTTGATGATACAATCTACACAAAAGGAGGGATCTGGAATATG
AATATACCTTTTGAATTTCGAGAAATTTCAGTCCACAACAGGTCACAAATCCAAGCTGGT
GCACGGAGATCGATTTCCAATGGCAAGGGTAACCCTGGAATAAGACTTTAGTTTAGAGAT
GTAGAAATTGGTGATAAATTTTCTGCATCAAAAGACACTCCAAGAATTATTCCCCCAAAG
AGAGCTTGGCGAAATTTTTCATGTAACTCTCAGGCCACAGGGAACCTAGCCAGTACGGGA
GATTGAAGTTGAAGGTGTGGCTTTGGCTACCAATTTCCTTCTATGTGTCATCACACTGCT
TCATCCTTGATCTTACTAAAGTTTACTTCAGTATTCATCAGAAAACAAATTCTATCAAGG
AGATGGTTTCTGGAGCTCTTGGGACAGAGGAACATGGTGTCAATGGGATACTTGCAAACA
CCAACTGATCTAGTCACA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved