Rattus_norvegicus Locus Mono:105:SNORA26
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Mono:105:SNORA26
Rattus_norvegicus
Mono:105:SNORA26
7
SNORA26
1001..1114
2114
GGGTTGTTTCCCTGTGTTCTTTCTTGATTGCTTCTATTTCCATTTTTAATTCCTTCAAC
TATTTGATTGTGTTTTCCTGGAATTCTTTCAGGGATTTTTGGGATTCCTCTCTGTAGGCT
TCTACTTGTTCTCTAAGGGAGTTCTTCAAGTCTTTCTTGAAGTCCTCCAGCATCATGATC
AAAAATGATTTTGAAACTAGATCTTGCTTTTCTGGTGTGTTTGGATATTCCATGTTTGTT
TTGATGGGAGAATTGGGCTCCGATGGTGCCATGTAGTCTTGGTTTCTGTTGCTTGGGTTC
CTGCGCTTGCCTCTCGCCATCAGATTATCTCTAGTGTTACTTTGTTCTGCTATTTCTGAC
AGTGGCTAGACTGTCCTATAAGCCTGTGTGTCAGGAGTGCTGTAGACCTGTTTTCCTCTC
TTTCAGTCAGTTATGGGGACAGAGTGTTCTGCTTTCGGGCGTGTAGTTTTTCCTCTCTAC
AGGTCTTCAGCTGTTCCTGTGGGCCTGTGTCTTGAGTTCACCAGGCAGCTTTCTTGCAGC
AGAAAATTTGGTCTTACCTGTGGTCCCGAGGCTCAAGTTCGCTGGTGGGGTGCTGCCCAC
GGGCTCTCTGCAGCGGCAGCAACCAGGAAGACCTGTGCCGCCCCTTCCGGGAGCTTCAGT
GCACCAGGGTTCCAGATGGTCTTTGGCTTTTTCCTCTGGCGTCCGAGATGTGTGTGCAGG
GAGCAGTCTCTTCTGGTTTCCCAGGCTTGTCTGCCTCTCTGAAGGTTTAGCTCTCCCTCC
CACGGGATTTGGGTGCAGAGAACTGTTTATCCGGTCTGTTTCCCCCTACCATACAGTTTC
TAATCATTATTCCTCTGTAATATCACTCAAGGTCAGAGATGGTGATTCCCCAGAAGTACT
TTTATTGTGGAGAATAGTTTGGATAACCGAAAACACCTGAGAACAATAATGCTGATCTAA
AATCCTAGATCGTGAAGATAATATTGTTCTTTAAAGAGGATATAAATATTGCCCCAGTAC
TTTAAGAGGCTAACACAGAAGGGTAAAGGAAGTCTCCATAAAACCCAGAGAGAAAAACTG
CACCTCCTCTTTGGATCCTGTCTGGAGTCACAGATGAAAAAAAAGAGGATATAAATAACT
CACTGAAAGAAATATATAAAAACACAGATAAACAGGTAGAAGCCCTTAAAGAGGAAACAA
ATATATCTCTTCAAATAATACATGACAATACAATCAAACAAGTGAAGGAATTGAATAACG
CAGTCCAAGACCTTAAAATGGAATTAGTAACAATAATGAAAGCCAAAATGGAGGCAACCG
TTGAAATGGAGAACCTAGGAAAGATATCAGGAATTACGGAAGTAAGCATCACCAACAGAA
TACAAGAGAAAGAAGACTTCAATAACAACAAAAAACAACAGAAATCCCATGGAAACTGAA
CAACACTCTATGCAATTATAACTTGGTCAGGGAAAAAAATAAAGAAGGAAATTACAGATA
TCCTGGAATTCAATAATAATGATGACACAGTTTACAAAGACATATGGGACACAATGAAAG
CAGTGCTAAGAGGGAAATTTGTAGCACTAAGTTCACTTTTAAAGAAACTTTGGGGTCTTA
CCCCAAAGTTAATAGGATACCTAAAAGCTCTAGAACAAATGAAAGCAAACACACCAAGAG
AAACTAGACTGGAGAAAATAGTCAAATACTGGACTGAAATTAACACAATATAAACAAAGA
ATTAACGAAAACAAAAGCTGGTTATTTGAGAAAATCCACAAGTTAGAGAAACCCTAGCCA
AATTAACTATAGCCCACAGAGACAGAATTCAAATTAGTAAAATCTGAAATGAAAAGGGAG
ACATAACAACAGAAATCGAGGAAATTCAAAAAATCATCAGCTCCTACTACAAAAGTCTAT
ACTCAACAAATCTGGAAAATCTGGAAGAAATGGACAATTTTCTAGACAGATACCAGGTAC
CAAAGTTAAATCAAGAACAGGTAAACTATCTAAACAGATCCATATCCCTTGAGGAAATAG
AAATTAGAAACCTCTCAACTAAAAAAAAAAAGCCTGGGACCAGATCACTTTAGGGATAAA
ACCAGAAGAAACACT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved