Rattus_norvegicus Locus Mono:527:SNORD22
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Mono:527:SNORD22
Rattus_norvegicus
Mono:527:SNORD22
11
SNORD22
1001..1125
2125
TATAAATAATAATACTAAAGAAACGCATACTTATTTTGTGCTTTCCTTCATAACAAATC
ATTCATTCAAAAGCAAGACACACTACAAGATACACACTTGCTATTCTGTCTAAGCATGTA
GATTTTGTGGACCCTTATATGATACCTTTGATTTATTGGTCATTCCAAAAAAATAACTTT
TTATCAACATTGTCAATGACACAAATATCTCCTTTATTGTTTCATTTTCTCCAAGTAATA
TGAGATATTTGAAAATATTCATTTTTTGCTGCTTGGACCCCAGCATCTGATGCAAAATGA
TTTCCTCACTGGATAACCTTGGCTGCACATGACTCAGAGCAATTCTCCACGTTCTCGATG
GGATTTCCATAGTATTACATGGTTTTCTTGCTACAGTGCTATTGCATTAAAATAATAATA
CACCCATATAGAATTCAAGATAGAAAACTTTTTCAGGTAAGAAAATAAAATATTTTTCTC
AGCCTCTCTGAAATTTAATCTTTTCATGAATTTACTGTTATTTGTACTTAGAATAACTAC
ACACCTCAGTATAGTTTCACCTATTTTTACTCTACTCTCATATCTCCCATAAACACACCA
GATTTTTTTGACTTTATTATCCTTGTAAGAGGATTATAATCAATGGATATGACTTAATGA
AAACAAATTTCTGACCACAAATTGGGAATAAAACATAAATTTTAAAAGTACAAATGAACA
GATCATATGTATATACATATATATACACACATATACATGTGTATGTGTATGTGTATGTGT
ATATGGTATATATGTATGAGTATATTGTAGGTGTATTGCATTGTTTGTGTATTGTATATA
TATTATATGTGTATATGTATAGAATCAAGAACTCACAATGTGGGGATATTGCTCAGCTGA
TGGAGGGCTACCCTTGGTTTTACCACCAGCACCAAATGTATTGACCTTGACGGCACTGTA
ATCACAAGGTAGACTTAGGACGCTATCAGAAGGTCAAGCTTTCCCTATGAAGATATTTCA
CACGTCTTACTTCCTGTCCTAGCTCCAGAGCCTGAAAAGACGAACCCACTGGGGCTGGCT
GGGGGAAAAGAGGACGTTTTGTTCCAGAAGGAACTGTCTAATGGATCTTTTGTATGTGTA
CAAAGGGAAGAATTATCACTTTGATTAAAGAGGAAACAGGGTGGTTTATCTGTTTTCCAG
GTCTGAGGAAAGGGATGAGGTGTGTGTTAGAGGTAGGTAGCCCTTCAAGTCACTGTAATT
AGGTGGGCAGGGCAGATTTTGCTTTCTACTCCTAATTGAAACTTTTACCTTACAGGAGCT
GAAATCAAAGATTCGATTACCCAGGCCAGTGGCACAGCAAACTTCAGAGCTCATGGAACA
CAGTCTGTTGATTCTTTATGGGTTTTTAGCATCTGAGCAGTATCAGCGGCACTTCAAGTG
AAATGGTTGATCTCTTCAGTACCGCTGGAGCAGATTAATATTTATTTCACTGCCAGAGGC
TACATTCCCCCCCCCATACCCCTTTCCTCTTCTCCTTAGACCACTTTTTAAAATTGATGA
AATCTTTGCAATTCCAAATTTATCTTCCTTGCTTACCACATTGTTAATCTGATCCTTCCA
TGGTTATTTGTGCTGTGTTCTTTTTGTTCCTAGTAATAAATGCTTTTTTATCCTAAAAAA
AAAAAGAAGTTCAAGTTTATCTTTGGTTTCCTAGAGGTACCCTTTACCACTGAACCATTT
CAGCAGCTCTTACGTGTGATTTTTTATTGTTAAAATAAATTAGATCAACAGTGTATAGAT
CAATAATATATTTTTCTTGGAGCCAAGGTAAGAATTGAGTGAGATAACACTTTTAATAAA
GTTATAATTATTAATGAAATGGAAGTGTACCCCTATGAAATTAATGTGTATACTGTTATA
AATAAACCATTACTTTTATTCTATTTATTTATATGGGATAGGGTGGGTACCTACATTGTA
TCAAGGTTTGTATGTAGAAGTCAAAGGTAATTGTGCAGAATTTATTTAGAAATTTCCTTC
ACTGACTAGTCACGGTTTTCTTTTCACTAAAGAAGTATTTAAAGACATTGGTTCCATCAT
GATCACCTCACTCACTTACTAACCAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved