Rattus_norvegicus Locus Mono:423:SNORA63
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Mono:423:SNORA63
Rattus_norvegicus
Mono:423:SNORA63
16
SNORA63
1001..1116
2116
GTAGAAGAATGCAGATCAATCCATTCTTATCACCATGTACAAAGCTTAAGTCCAAGTGG
ATCAAGGACCCCCACATCAAACCAGATACACTCAAACTAATAGAACAAAAAGTGGGGAAG
AATCTCAATCACATGGTACTGGAGAAATTTTCCTGAAGAAAAATACCAATGGCTAATGCT
CTAAGATCAAGAATCAACAAATGGGACCTCATAAAACTGCAAAGCTTCTGTAAGGCAAAG
GACAATGTCATTAGGACAAAACAGCAACCGATAGATTGGGAAAAGATCTTTACCAACCCT
ACATCTTATACAGATCTAATATCCAAAATATACAAAGAACTCAAGAAGTTAGACTGCAGG
GAGACAAATAATCCTATTGAAAAATGGGATGCAGAGCTAAACAAAGAATTCTCAGCTGAG
GAATACAGAATGGCTGAGAAGCCCCTAAAGAAATGTTCAACATTTCATCAGAGAAATGCA
AATCAAAACAACCCTGAGATCCCACCTCACACCAGTCAGAATGGCTAAGATCAAGAATTC
AGGTGACAGCAGATGCTGGTGAGGATGTGGAGAAAGAGGAACACTCCTCCACTGTTGGTG
GGATTGCAAACTGGTACAACCACTCTGGAAATCAGTCTGGAGGTTCCTCAGAAAATTGGA
GAATCTTTTGGGTGTATGCCCAAGAGAAGTATAGCTAGGTCCTCAGGTAGTGGAATGTCC
AACATATAACAAAGACACATGCTCCACTATGTCCATAGCAGCCTTATTTATAATAACCAG
AAGCTGGAAAGAACCCAGATGCCCTTCAACAGAGGAATGGATACAGAAAATGTGGTACAT
CTACACAATGGAGTACTACTCAGCTATCAAGAACAATGACTTCATGAAATTCATAGGCAA
ATGGAATGAACTAGAAAATATCATCCTGAGTGAGGTAACCCAATTACAGAAAAACACACT
GTTTATGCACTCACTGACAAGTGGATATTAACCCAAAAGCCATGCAGGTACAGTTACACT
AAAACTGAAGTGTTCTATCATCATTCCCCCTGCTTAAAGCATTACTACCTCTGCCTAGCT
CTACCATAGTAAGGCAGAGATGCTTGGCTTCAAACACTTTTAAAAAGAAATAGAAAGAAA
AAAAAAAAAGCTCGGATTACCCAAGATACAATCCACACAATCCACAGACCACATGAAGCT
CAAGAAGGACGACCAAAGTGCAGATGCTTCACTTCCTAAAAAGGGAAACAAATATTCATA
GGAGGGGATATGGAGGCAAGTTTGGAGCAGAGATTGAAGGGCCAGCCATTCAGAACCTGC
CCTACATGGGGATACATCATACATGTATGTATGTATGTATGTATGTATGTATGTATGTAT
GTATGTATGTATGTGTATACAACCATCAAAACTAGATAAGATTGATGAAGTTAAGAAGTG
CAGGCTGACAGGAGCTGGATATAGCTGTCTCCTGAGAGGCACAGACAGAGCACGACAAAT
AAGAGGTGAATGCTAACAGCAAACCATTGAACTGAGAACAGGATTCCGGTTGGAGGAGTT
AGAGAACGGATTGAAAGAGCTAAAGGGGCTTGCAACCCTATAAGAACAACAATGCTAACC
AACCAGAGCTCTCAGAGACTAAACCACTACCCAAAGACTATACATGGACTGACCCATGGC
TCCAGCTGCATATGTAGCAAAGGATAGCCTTGTTGGGCACCAATGGGAGTAGAAGCCCTT
GGTCCTGCCTAGGCTGGACCTCCCAGTGTAGGGGAATGTTGGGGGGGCAGAAAGAGGGGG
TGATTGGGGAAGGGAAAACCTGTATAAAGAAGGGGAGGAAGATGGGATAGGGGACTTATG
TCTGGGAAACTGGGAGAGGGAATAACATTTGAAACGTAAATAAAAAATATTCAATTTAAA
AAAAAAAGAAAGTTAGGGCCACTAATTCCTAGCAATATGAGAAAGCCATTTCAAAATACA
AGCAGATGTGAATTTTCTTTTCTGATTTAAAACAACATACAAATCAGAAAACATAGTTCA
TAAAATCACTACTAACATTTTGATACATTTTCTTCTATGCTTGTTTTCCTTTATATTTCT
ATTCCTACATAGATGGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved