Rattus_norvegicus Locus Mono:150:SNORA73
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Mono:150:SNORA73
Rattus_norvegicus
Mono:150:SNORA73
6
SNORA73
1001..1204
2204
GTGGGCTGCAGGCTCTGTGTAGTGACTTCACTAATTAGGTGCTCAAATGCTGTGAGATT
ATGGGGTCAGGGACAGATGGTTACAAGGCCTCTGACCTCAGGAACCAGAGTGTGCACAAT
GATGGGAGACAGAGGGAGCTCATGGGTGTGAGACATGGCTGTATTGTACACTAGGGACTC
AGTATTGGCTTCAGGTGTGCCACAAGTGAGCACTAGGGTGGAAGAGTGCATGCTGTTGAT
GTGACCTGCCAGGATTAATGTGGGGTGATGGTTGTCTGTGCTGGGTAGGGCATGGGGACT
TGAAGAAGTGTCTCATATTCTCTGTTTGCACAGCCAGGGTGTGTGAAGTATGACAATGAG
AAGTAGACCCTGTGACTCGGTCAGATAGGGTATGTGTAGCACAGTGGAAGTGTATAGGGG
TTAAGAGTATGTGGGTGAGTTATTTGTGATCTAGTTTTACCAACTGGAGTTTCCGGTATG
GCAGAAGAGTGCCTGAGGCTGAGATGGAGTTTGTTGCTCTCACAGCTTCAACTATTTATA
TGCTTTCCTGTGTGGGTCCTTGCAAGTTCTATGGCTAGCAGCAGAATGATCTGAGGAGAG
GCAAGAGTGAGATTCAGTTCAGTAAGACTTTAGTTATGTGTCACTGGTTCAAACTTCTGG
AATCTGTCATTGGGTGGTTTATTTTAGCCATACTTAAGCACAGCATAATTTTGGAAAAAA
CTTTCCTGGTTACAATTAACTCAGTCCTGACTAAACAACAAAGTTTAAGATATGTTTACA
TTGAAATCCTTACAAAGTACATATGACGTCTTCCTTAAAGATGGGTTCTGTTGACTTAGA
AGCAATGCTTAAGATAAGGGAGAGGTAAACCATGCCTGTGGGAGCCAGGATTGGTCTGGC
CCTAAGATACCATAGAGGCCACTTAGGCTGTTGAAAAGTATAAATGACATCTCTCATAGG
TTTTAGTAACTGAGAAGTAATGCTCAACACTTAAGGGGGTTCCAACATGGACATCCTGGC
AGGTCACTCTCCCTGGGCTCTGTCCTAGTGGCATACAGGATCATAGCGTACTGCCTGATG
ATGTATAGTCCCTTTCCACAACGTTGGAGATGAAGCTGGGCTTTGAGTCTGCGCTTGCAT
ATTCCTATGACTTCTCAGAGTCCTGTGGGCAGTGACTGAGGAGACAAACCATGGAGGAGA
CCAAAGGGGAAAAAAAAAGACTTAAGGGGGTAAAAACAATCTTTGATAAATGAACATAGT
AATCCAGGGAATTCATGTGAATCATGGCCTACAGATAGAAAAAAAAATCACCAAGTTGTA
AATTACATCCTTTCTGTGAAGAGACAAGTCTGTATGTCTAACTTTCCCGGCTTTCTCAGT
GTTTGTTTGTCTGTGTACACAAGGCCCTCTGACCCTCTGTATTTCCCCTCAGAGAAGACC
ACTTTGAAAGGAAAAGACATACCTGACAAATGTTCCCATGATGTGGTTAACAAAGTTATT
TTCAGGAGTTTGGTAGAGTAAGTAACATTTTATATTAATAGACCATTGGATTACTTAGTC
TGTGTGAACTAACCCAGAGAGTCTCGTTTGTCCTGTCTCCCTCAAAAGAATTTAGCAATG
CATAAAGTAAGGTCAGCTCTATGACTTGAGTCTTTGTCATGAAGTAATTAGTAATTTTCA
TACCATTATAAGTATGTAATTCTTCGATGTCGAACAAAAAAGTCCTAAATTTTATTGCTG
CTTTGACATTTGTACTTCTCAAAAAAGTTTCTAAAAATATAACTTTCATAGATAAAATCA
GATAAATTCTGATTTTCTGTCTCTCTCTCTCTGTCTGCCTTTTTTTCATCCCTGGAAAAA
GCGTGAAGGTCAGAGGAAAATGTCTACTGCCTTCCTCTATTGCTCTCTATTATTTGGGGC
AGGGTCTCTCATTGACCCTGGAGCTTTGTTTTGTCCTGAACCAGTTAGCCAGGAAGACCC
TGGAATTTTTCCCATTTTCTACTCCATCCAATTCTGGGGTTACAAACATAACCCCAGAAT
TAGTTTTTAGGAAAAGAGAGTAAAGAGAATCAGGTGGGGATTTTCATCCACGGTTCAAAA
AATAGGGAAAAATTAGTCACTACCTCCAAGTAGAGAGTTGTGATGAATGTCTGTAACTCC
AGGGAGAGTGAATGCAGGCATATATTGTAGAAGTTATTAAGGTTA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved