Rattus_norvegicus Locus Mono:620:SNORA71
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Mono:620:SNORA71
Rattus_norvegicus
Mono:620:SNORA71
1
SNORA71
1001..1132
2132
GCCCCTGTCAGAGATACCTCTGAGTTCAGGGCATGGTTTTATCACAGATTGGAGGGAAG
TCAATAACCTTATGTTGAAATGCACAGCTGGAAACTGCTCTCAGTTCTTGCCCCTTTGCT
TATCTGACTACACTGCTGCCTACTAAAGAAAGATACAGAACTATGGACATGACTCAGGAA
TACCTTACAAGGAAGTTCAGAACCACACCTTTTCAAAGTTTCTGCTCCCTCTACTAGTCT
GATGGAGAATTACACTAACCTTGGTCTCAGAAAATTTTGATTAAACAATGAATTTGGGTT
GATGGACAGTCTGTGGGATTGTTGAGACTTTGTTGAAGGGAATCCACGGAAACAGTCTTA
AAAGGATGAGGACAAGTCAAAAGAGCTATATAGATACAGAATTCGATGTTAGCACCCAAC
TTCCCTGGGTGCTCTAGACTCCATTCGCCCATCACTGTCTGAATACTGCATACCCTACTA
CTTGTTAAACACATGTTCTACTGGCCAATTCAAATAAGGTTGTTTGGACTACTGATAAGG
TCATGGTTGTAGTCTTAGTGGACAAAGGTAGGAAATTCACAGGAGGATATAAATGATGTG
GACTTTATTGTTTTCAGACCAACATCTCAAATCCAAAACCAAACAACAACAACAAAACAT
GGAAAAACCAAGCACCTGCAGTCTCATTCTATCACAAATGCTCTCTCCAGTGTCCTGTTG
TAAGCAATGGATCCTGCAAAGCCTTTTTGGTATATGTGATCATAGCAAAATATTCTCATA
TGTTGATGAAAATATACCTCCATGTCTCTACTCTTTATGTTCCAACACTAGATGTAAAGC
CCTAGTTATATACTCACACAAAGGCTGCATGGAGCCCAGCATGAACATGGCTTCTCACAA
AAATCTCATCAGATTCCTAAATCAAGCATATCATTGTTGCTGGAATTTCCAACCCTAGTA
AGCCATATAAAGAACACACAATCCAGTTATTATAAACTAACCCCTATATTCGAAAGTGAT
TGTAGGTTGCCAGTGCCCTGGTCATTGGTACTGAAGGGAGAGGATGCAGAAAGTCTTTCC
CCATGTTTGGAGGACCCAACCTTATCCTTGCCAAACCTTGGTGCTTTCCCACATTGCCCA
CTGCCTGTCCTTCTAAAAAAATAATAATTAAAGCTATATGCCTAGATTGGGCAGATCTAG
CACTCTACTAACTTGTTCCACAGCTATGAGACTCCTTGTTATTTGTGGTTTCTCTTGGCC
AGGTTGTTCTGGTCCAGTGTGGCTTCCCCTTTTTCACTGTCCTCTCTTCCCCTCCTGTTC
TCCCTCCCCTCTCCCACCTATCCCCTACTCTTAAACCTCCAGTCCTTTCTTTTTCCTCTT
ATGTCTAATCACCAGCTCTAGCCATTATGGGCCACTTAAAATTCAATGTTCCAAGGGGAA
GCTTACTGACTGCCCATGGGAGGACAGAAGTCTGATCCAGAGCAGAGACTGGCAAGTAGA
CAGAAAACAATAATGATTTCAGAGCAGTGGGAAAAGGAGAGGAGCCAGGTTTTGATTTGA
TAAGTTAATAGAAACTTGTTGGGTAGAAAGAAGAAACTAATATTAAAGGTGATGTTTTTG
TTGTTTTCATTGATAAGTCAGAAGTTTCTTTAAAATACATATGACATCACCTGAACTGTG
GGGCAACCCTTCTTGAAGAAGCAGAATTAACACCAGAATACTAACAGTACCAGGCCAACC
CACCACTCTTCTTTACTATCAAAGCAGAAACAGCCCTCTCTAGGTTTCGTTTTCTCTAAG
CTGGAAGCTTGCCAGTTTCACTCAGGAATTGAGGGCGTGGCAAACTGATAATCCTTCCAT
ATATAAATGCCTTGCTCATCCTAGAACCCCTAGAATGCCTTTGAGTTTGGAAGAGTCTCT
TGGCCTGAATTAAAGTGCTATGGAACAAGTTCTTTCTCCCAGCACCATGAGGTAAAGACT
TTCTCATTTTTGCTCACCTTAATTCTGTATATATTGACACTCTAAACTCAGAACCATAAC
TGATGGGTTCCTGGGCATGCTTCATCCTGTTCATCATTCTGATGTTGATAAGTTTTCAAA
GTCTGCTCAGTGGGGAAGGTTTTGGATAAGAGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved