Rattus_norvegicus Locus Poly:19:SNORD115
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Poly:19:SNORD115
Rattus_norvegicus
Poly:19:SNORD115
1
SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115
1001..1085, 2847..2923, 4764..4843, 7172..7249, 9113..9189, 10941..11018, 12776..12853, 14611..14685, 16439..16516, 19712..19789, 21545..21622, 23384..23461
24461
CCTTTAAGAAAATTGAAACTGGGAATGTGGAGAAGCTGAAGTTTCAGGTGGTGCCTTGG
GTCCCACTTCCTGTCCAATTTCGTGCATAGTGTTTAATCATTCTCTTACTAAAGTTAACT
GCAGAATTCATCAAGAAACAAATCCTACCTAACATGTGAATTCAGGAGCATGCCTGGTCT
GAAGGAACCTGATGCCACTGTAAGGCATGAAACATTGCTTGAACTAGTCTCAAAAACTTT
GGTCCCCTTCTCAATTTAGTGATATGGCAATCCATTAAATGCTAACACAAGTGGATCCAT
AGCTGAATTTTGGTCACTCTCTTCTGTGACACTGAACCTCTGCAGTATTCATTTACCAGC
ATTGAGCACCAGGTTTTATAATGAAAATTGGGCTATGGAGAAGAATAATCACTCCCTTGT
AGATTAAATGAGAAATGTATTGCTCCCTTTGAACAGTCTACAAAATCTCTATGTCGTTGC
TCATTTATTGCTCTAACCATATTACTCCGGGAACTCAACCTGAGTCTTGGTCCCTAACAA
TGTTTAAGCAAAGGAAAGATGGGATCTGGGTAACTGCTTCAAATGGAAAAGTGACATTGT
GTTTCAATGCACTGCAATTTTGTACTTTCATTGACCTTACTAACAGGATAGGGATTTAAC
CACCGAGGGGCTTGAGCATGGTAACAGAATGGGGAGCTGCAAGAGGGATTCTGGTAAGTG
GGATCATACCTTAGAGCTCTTATGCAGTCTCCTTCCCATTAAATTATTTTGTGAAAGGAG
GGAAAACAAGTGTCTTCACATCTTCTTCTTTCCTCCTGTAAAAAAGGAATTCTTCAAAAA
TTCAAGCAAGGGTTCCCTTACGTCCCTACAAGAGGTTTTACCCCTGCAGACCTCTGGACT
TACAAGTGATGATTCATAACTCTGAGGCAGTGCTGGCAGCCCATGTAAACTCTGGTATTA
GATGATACTAAGTTATGGTTAGCTGTATTCTGCATGGGTCTGGGTCTATGTCGATGATAG
CATCAAAAGGTCGTAAAGGGAGATGATGACATAAAAATCATGCTCAATAGTATTACGCTG
AGGCCCAAACAGGGATACAGTGTTACAAGCAGTCTTTTCTTTTTGACGACCATTTTTAGG
ACTCATCTGAAGTGCATGTTCTGTTTCCCCCTAGAGGAAACCTAAACACTCTTGGTGCAC
TTCTGTTGGCAAACATTGCCTGCTCACTAGTACCTAGTCTCACATTCCACTTCTGGGCAA
TTCTGCATCACCTACCCATTGCTCATGATCCTGTCTTTTCTGATGTCTTGCAATCATCTG
GCATGCCTCATTGCAGCCCAGAGAATCACCAATCTTAGGTAAGTAAAAAGATCATGTCTA
ATGGCTTCCACTACTAGTGACTTTTGTCTCCACTTTTTGGGTACTGAATCTCTCCCATCT
CATGTTTTTTATTTAATTAAAAACAAACAAAAAAAACAGTTCTCAGAAACTAAGGGACAA
TTCTCAATGTGTTCTGCCCTTCAGAACTGCAGATTTAAAAATCATCTGGTATATCCTAAT
CCCAATAACTCATATGCACATAAGTTTGAGCTACGTGCCACAGACCCAAGAGGATAACAC
CTTCCCGTACTCATGTCTCCATTAATGTTGCTTACATTGTGAGGAGTTGCAGTAACTCAA
CACAGACTTCCAAGCCTATGAAGAGATTTTGATTTCCCATGATATTGGAGACCCAAATGA
CAGATCCTGAATTAGCGAGGGTGAAGTAATCTATAAATCTCCAACAGGGATGACTTCCAC
ATAATTTATGCCAGAAAAGCAAACATTTTAGTAAATTTTGAAAAATGTTCACTCCACAGA
GAAACTGGACATATGGAAAAGTTGAAGCTTCAGGTGTTGCCTTGGGTCACATTTCCTTTC
TAATTTCCATCACAGTGTTTCAACCTGCTCTTACTAAATTTCACCGAAGAATTCAGCAGG
AAAAAATCAAAAGCAGAAGGTTGTTTCAGGAGCAGGCCTGGTAAGGGAACCTGATGCCAC
TGTAAGGCATGCCAACATTGCCTGACCTAGTTTCAAGAACTTTGGTCACCTTCTCAGTTT
AGTGACATGGCAATCCTTTAAAGCTTAATACAAATGGATCCATGGCCAAATATTGGTTAC
TCTATACTATGCCACTGACTCTCTGGAGCATTCACATAGCATTGGACACTGATTATTAAC
ATGCATGTTGGACTTTGAAGAGGAATGATCTCTCCCTTGCAGAATGATTAGGAAACACAC
AGTTCCATTCATACAGTCTCTAAAATCTTTATGAAGTTGCTCACTTATTGTCCTCTCTCT
ATTACTTAGGGAATTTAATGTGATTGTTGGTCACTGACAATATTTAGACAAAGACAGAGG
GGATATGGGTAATTGTTTCAAGAGGAAGAATTGAACCTGTGTGGCAATGGTTTAGTCTTT
TGTATTTTCATTGACAATACTATTACAATAGAGAAGAAACCTTCTGGAGCCTGGCCACAG
TAGCATGAAAGAGGCAGCTGCAAGAGAGATTTTTTTCAGGGTCTTTATTCCTGTAGAGTT
AATATACAGTCTCTCTCATCCTAAAATTATTTTATGAAAAGAAGAGCAAACATGTGCCTT
GATTTATTTTTCTCTTTCCTCATTTAGAGAAGGCATTCTGCAAAGATTTAAGCTAGAGGT
CCCTTTAATCCCTGGATGAGCTTTGAAACCTGAAGCCTTCCATACTTACAAGCAACCATT
CATAACTCTAAGGCAGTATTAATAACTCAGATAACCCATGGTGTTAGGTGATATCAAATA
ATAGGTAGATGTGCTTTGCATGGGTGTGCATCAATGATGAAAACTAAAATTATGAAGAGA
GATGATGGCATAAAAATCATGCTCAATTGGATTATGCCAAATCCCAACCGAGATATGGAG
TTACAAGCAGTCACTTTTCTCTTTGAGGACCACTTGCAGGATGCTTATGAGCTCCTCAGA
TGCACTTGTGTTGTTTCCCCCTAGAGGGAACCTGATCATTCTCAGTGCAATTTTGTTAGC
AAACAGTGCCTGGTAGCTAGAATGTAGTCTAACATTCTAATTGTGTGCAAGTCTGTGAGG
CACACCCATTGATTCTGTGTCTTCTGTTATCTCGCAGTCATCTGGCATGCCTCTTTGCAG
ATCAAAGAATCAAAGACCTCAGGTAATTGAACAGATCATGTCTAATGTCTTCCCCTACTA
ATGAACCATGTCTCCATTTTTGGCTTCTAAATCTCAGCCATTCAAAATCTTTGTATTAAA
AAAGAAACAAAAACAGAACCTAACAACTAAAGGCCAATTCTGAGCATGATCTGCCCTATA
GAACTGGAGACTTACAAAGCATAAGAAATTTCCTAATTCCCAAAGACTCCTACACTCATA
TGTTTGAGCTACTTTGGCATAGATCAAAGAGGATAGTACCTTCCCATATTTGGGATCTCT
ATTTTTTTTACTTACATTGTGAGGAGTTACAGGGGTGCAACACAGGTTTCCAAGCTTGTG
CAGAGTTTTCTATTTCCTATGCCACTAAAGGAGCATGGGCCAGAGCATGGATTAGTGAGG
GAGATGTATTCTATAAATCTCCAACAGGGTCAGCCTCCACATAATGTATTCCCCAAAAGC
AAAGCTTTGAGCAAATTTCAAAAAACTCTCACTCCACAGAGAACCTGGCTTGTGGAGAAG
TTGAAGTTTCAGGTGTCTACTTCATCCCCAAATCCTTAACAGTGTCTCATCCTTATCTTA
TTAAAATTCACTGAAGAATTCTTCAGGAAACAAATTCTATACAGGAGGTGATTTTAGGAG
CAGGTGTAATCTGAAGGAACCTGATGTTTCTGTGAGGCATGACAACAGGGCCTGAAATAG
TTTCAGGAACTTTGGTCACCTTCTCAATTTAGTGAAATTGCAATCCTTTAAAGCCTAACA
CATATGGATCCAAGGCCAAATATCAGTCACTCTCTTCTGTACTTCTAACTCTCTCTAGCA
TTCACATACCAGTATTAGACTTGGAGTTTGTTTTTTTTTTTTTTTTTGGTTCTTTTTTTT
CGGAGCTGGGAACCAAACCCAGGGTCTTGCACTTCCTAGGCAAGCGCTGAACCACTGAGC
TAAATCCCCAACCCTGGACTTGGAGTTTTAACGTGAAGGTTGGACTTCGGACTGGAATGA
TCAGTCCCTTGGAGTTTGAGTGAGAAAAACATGGTTCCCTTCAAACAATCTTTAAATCTC
TATGTAGTTGTTGATTTAGTGTCCTCTTTGTATTACTCAGGGAACTCAACTTATGTGATC
TGGGTAATTACTTCAATAGGGAGAAGTGAGTCTGTTTTGCAATGCATAAGCTGTTTGTAT
TTTCATTGAACTTACTAAGCGGATAGGGATATAATCATCTGGAAGATGGGTATGATAGCA
TAGAACAGGCAGCTGTAAGAGGGATTCTGCACAGTGGCATCACACCTGTAGAGCTTTTAT
ACAGTCTTTCTCACAAAAATTATTTTGTGAAAAAAAGGGCATACAAGTGCCTTCACCTCT
TGCTCTTTCCTCATTAAGAGAAGACATTCTTCAAATATTCAAGCAAGGGTCCCCTTGCAT
CCCCAGAAGAGCTTTCAACTCAGTAGCCCTCTGCACTTACAAGTGATTATTCATAACTCT
GAGGCAGTATTGGCAGCCCATCTAACCCATGGTGTTAGGTGATACTAAATTATGGGTAGC
TGTATTCTGCCTGGGTCTGGGTCAGGGTCAATTGTGGCATCAAAAGCTCACAAAGAGAGA
TGATGGTATAAAAAATCATGCTCAATAGGATTTAACTGAAGCCCATCCAGGGATACAGGG
TTACAAGAATTCCTTTTTCTCTTTGAGGACCACTTGTGTGTTACATTGGAAGTCCTCTTA
TGCTTTTGTGCTATTTCCCCTGAGAGGGAACCTGCATATGCTTAGTGCATATTTATTGGC
AAACACCACTGGCAAACTAGTTACTAGTCTGTGAGGCCCACCCATTGCTCCTGACCCTAT
CACTTCTGATGTATTGCATTCATTGTGCATCCCCTGTTGCAGCACAGACAATCACAGAAC
TTATGTGTGAAAAGATCATGTCAAATGGTTTCCCCTACTAATGATTTTGCCTCCACTTTT
TGGACTCTGAATCTCAGCCAATCTAAAGGTTTAAAATTAAAAACAAAATAACAGAATGCA
GCAACTAAGGGACACTTCTCCACAAGTTCTGCCCTTTAGTACTGCAGATTTAGGTAGCAG
GTGAAATTTACAAACTCCCAATAACACTCCTACAAACATAGGTTTGACCTACTTGGCATA
GATCAACAAGGATAACACCTTCCAGAACTAGGGGTCTCCATCTTTCTTACTTACATTGTG
AGGATTTGCAAGAACACAGCACAGACTTGGAAGCCTGTGCAGAGTTTGCAGTTTTCCAAG
ACACTGGAGACAGAAGTTGCAGGGCCTGGATTAGTGTGTGAGAAGTAGACTACAAATCTC
CAACAGGGATAGCCTCCACATGATGTATTTCCAAAAAGCAAACCATTGTTCAAATTTTCA
AAAAACGCTAACTGCACGAGGAAACTGGTCAAGTGGAGAAGTAGATGTTTCCAGTGTTGC
CTTGGGTCCGATTTCCCTCTCAATTTCCTTTACATTGTTTCATCTTTTTCTTAATAATTT
TCTCTGCAGAATTCATCAGGAAATATATCTTACCTATCAGGAGATTTCAAGAGCAGGACT
GATCTGAAGAAACCTGATGCCATTGTGAAGCATGGCAATATGCTTGATCTAGTTTCAGGA
AATTTAGTCACATTCTCAGTTTACTGACATTGCAATCCTTTAAAGCCTAAAGCATATGGA
TTCAAGGCTGAATATTGTTCACTCTCTTCTGTGTCACTGGCTCTCTGCAGCATTCACATA
CTACCATTGGGCACTGAGTTTTAACCTGCAGGTTGGACTTTGGAGGGGAATGATCACTCC
CTTACTAATTGGATGAGAAACATTCTGTTCTCTTCAAACAGTCTCTAAAATCTCTATGTA
GTGGCTCATTTATTGTCCTCTCCATATTATTCAGGAAACTCAACCTGAGTCTTGGTCCCT
GGCAATGTTTTGGCAAAGGACAGACGTGATCTGGGTACTTGCCTCAAGAAGAAGTGAGTC
CAGTGCAATGCATTGGACTTTTTTATTTTCATTAAACTTACTAACAAGATATGGAAAGGT
TTCTTAAATAAAAATAATGCAATACAAGTCAGAAATGAATTGCAATTCTCAGTATGTTCT
GTCCCTTTGAACTGCACATTAAAAATATAGAGAAATTCCTTTCTACCTGTAGTTCATACT
GCCATAAAATTGAATTTCGTGGAAGAGATCCTAGATCATACTATCTACACAAAAGAGGGA
TCTGGAATATGAATATACCTTTTGAATTTGGAGAAATTTCAGTCCTCACACACCTCACCA
AACAAGCTGGTCCACAGAGATCAATCCCAATGACAAGGGGAACCCAGGTGTAAGACTTTA
ATTTAGAGATGTAGAAACTGGCGAGAAATTTCCTTCATCAAATGACACCCCAAGAATTAT
TCCCCCAAAGAGAGCTTGGTGAAATTTTTCATGAAACTCTCAGGCTACAGGGAACCTAGC
CAGTACGGGAGCTTGAAGTTGAAGGTGTGGCTTTGGCTACCAATTCCCTTCTATGTGTCA
TCACACTGCTTCATCCTTCACCTTACTAAAGTTTACTTCAGTATTCATCAGAAAACAAAT
GCTATCAAGGAGATGGTTTCTGGAGCAGACCTTAATGATCTCTTAGGGAAGTAAATTTCC
AGGGTGTTGAGAATGTCAGCATGGAAGTGGGAGCTGCAAGAGGGATTCTGCTCAGTGGCA
TCATACATTAGACTTCATATAATGTCTCCCTAACATTAACATGATTGTATGAACTGAAGT
GATACAATTGCCCTCACATCTTGCTCTTTCCTTTTTAGAGAGGACAGTCTTCAAATTCAA
GCTAGGTCTCCCCTTATTCCACACAAGAGCCTTATGCCCAGGTATCCTCTCACTTGCAAG
TGAGGATTCAAATTCTGAGGCAGTGTTGGCAGTCCAGGTAAGCCATGGTGTGGTGAAATT
AAATTAATGACAGTTGTGTCCTGCCTGTGTCTGGGTCAATGATGACAACAAAAAGTCAAG
AACAGGATGATGACATAAAAATCATGCTCAATAGGATTACCCTGAGGCCCAACCTAGGAG
CCAGGATTTCAAGCAGTCCTTTGTCTCTTTGAGGACCTCTTACGGGACTCATCTGAGCTG
CTCTGATGCCCTGTGTTCTTTCCCTTCTGTGGGAACCTAGACAATCTTAGTGCAAGTGTC
TAGGCAAACACTGCCTGCCAACTAACACCTAGTCTCATAATCTGCTTGTGTGCAAGTCTA
CAACACCATCCCCTTCAACATTACCCTCTCTTCTCTCATGTCTTGCAGTCATCTGGCATC
ACCCCTGCAGTCCAGTAGAGCACTATTCCCAGGTGAGCGAAATGATCACGAATAATGGAT
TGAACTTCTTATAAGATCTTCCTCAGTATTTTGACCATTAATTTCAGGCCATCAAAGGAT
TCTTAATTAAAAATAATGCAATACAAGGCAGAAATGAATTGCAATTCTCAGTATGTTCTG
TCCCTTTGAACTGCACAATTAAAAATGTAGAGAAATTCCATTTTACCTGTTGTTCATACA
GCCATAAAATTGAATTTCTTGGAAGAAATCCTAGATGGTACTATGTACATAAAAGGAGGG
ATCTGGAATATGAATATACCTTTTGAAATTGGAGAAATTTCAGTCCGCACACAGGCTCAC
AAATCCAAGCTGGTCCACAGAGATCGATTTCCAATGACAAGGGGAACCCAGCTTTAAGAC
TTTAGTATAGAGATGTAGACATTGGCGATAAATTTACTGCATCAAAAGACACCCCAAGGA
TTATTCCCCCAAAGAGAGCTTGGCAATCTTTTTCATGAAACTCTCAGGCCACAGGGAACC
TAGCCAGTACGGGAGCTTGAAGTTGAAGGAGTGGCTTAGGCTACCAATATTCATTCCAAG
TGTCCTTACACTGATTCATCCTTGTTCTTACTAAAGTTTACTTCAGTATTCATCAGAAAA
AAATGGTATGCAGGAGATGGCTTCTGGAGCGGTTGGGACAGAGGAACGTGATGTCAATGG
GATACTCGCAAAAACCACCTGATATAGTCACAATAATTTTGGTCACATTCTCAGTTTTGT
CACATGGCAATCACTGAGTGCTAACACTCAGGGATTCATGGCCGAAATACTTGCGGCTTT
CTTCTGGGCAACTGATTCTCTTCTGCATTCACTTACTAGCTGTGGGAACTGATTGTTACC
ATGCAGTATGGAAATTGGGAGGAATGAACACAGCCTAGCACATAAAATTTGAAATGCACA
AGTCTCTTGAAACTTGGTTAAGGTATATGTAATTGTTCATGTATTGTCTTCCACGTATGA
CTCAGGGAACTTCACCTTTGTGTTGGATTCTCACAAGGTTTAGCAATTAAAATATTTGAT
AGGTGTAACTGAACAAGAGCATGTGTGATCCACTTCATCAATGATTTGGTTTTGGGTACC
TATTGACCTAATGATCTCTTAGGGAAGTACCTTTCCAGGGTGTTGGGAATGTCAGCATGG
AAGTGGGACTGCAGAAGTGATTCACCTCAGTGGCATCATACATAAGACTTCTTTTTTTTT
TTTTTTTTCGGAGCTGGGGACCGAACCCAGGGCCTTGCGCTTCCTAGGTAAGCGCTCTAC
CACTGAGCTAAATCCCCAGCCATACATAAGACTTCTTATACAGTCTCCTTAAAATTAACA
TGATTGTATGATCTGAAGGGATACAATTGCCCTCACATCTTGCTCTTTCCTTTTTAGAGA
GGACAGTCTTGAAAATCATGCAAGGTCTCGCCTTATTCCACACAAGAGCACTGTGCCCTT
GTATCCTCTGCACTTGCAAGTGAGGATTCAAATTCTGAGGCAGTGTTGGCAGCCCAGGTA
AGCCATGGTGCTGGTGAAATTAAATTAGTGACAGTTGTGTCCTGCCTGTGTCTGGGTCAA
TGATGACAACAAAAGTCAAGAACAGGAGGATGACATAAAATACATGCTCAATAGGATTAC
GCTGAGGCCCAACCAGGGAGCCAGGGTTACAAGCACTACTTAGTCTCTTTGAAGACCACT
TGCAGGACTCATCTGAGCTGCTCTGATGCCCTTGTGCTCTTTCCCCTCTGTGGGAACCTG
GACAATCTTAGTGCAACTGTGCTGGCAAACACTACCTGCCAACTAGCACCTAGTGTCCTA
ATCTGCTTGTGTGCAAGTCTGCAACACCAACCCTGTCATCATTACCCACTCTTCTCTGAT
GTCTTGCAGTCATCTGGCATCACCCCTGCAGTCCAGTGGATCCCTATTCCCAAGTGAGTA
AAATGTTCACGAATAATGGATTGAACTTCTTATAAGATATTCTTCAGTATTTTGACCATT
AATTTCAGCCCCTCAAAGGTTTCTTAATTAAAAATAATGCAATACAAGTCAGAAATGAAT
TGTAATTCTTTGTATGTTCTGTCCCTTTGAACTGCACAATTAAAAAGTTAAACAAATTCC
TTTCTACCTGTAGTTCATACACCCATAAAATTGAATTTCTTGGATGAGATCCTAGATGAT
ACTATCTACACAAAAGAAGGGATCTGGAATATGAATATACCTTTTGAATATGGAAAAATT
TCAGTCCACACACAGGCTCACAAAACCAAGCTGTTCCACAGAGATCGATTTCCAATGACA
GGGGAACACAAGAGTAAGACTTTAGTTTAGAGATGTAAAAATTGGCGATATATTTGCTGC
ATCAAAAGAGACACCAAGAATTGTTCCCCCAAAGAGAACTTGGCAAACTTTTTCACGAAA
CTCTCTGGCCACAGGAAACCTAGCAAGAAAGGGAGCTTGCAGTTGAAGGAGTGGTTTTGG
CTACCAATTCCCTTCCCTGTGTCCTCACAGTACTTCATCCTTGATCTTGCTAAAGTTTAC
TTCAGTATTCATGAGAAAACAAATGCTATCCAGGCGATGGCTTCTGGAACGGGTGGGAGA
GAGGAACGTGATGTCACTGGGATACTTGCAAACACCAACTGATCTAGTCGCAGTAATTTT
GGTCAAATTATCAGTTTATATCACCTGGCAATCACTGAGTGCTACCACTCAGGGTTTCAT
GGCCTTAATAGTAGTCGCTTTCTTTTGGGCAACTGATTATCTTCAGCATTCACTTGCCAG
CTGTGGAAACTGATTGCTACCATGAAGTAGGGACATGGGGAGGAATGAACATAGCCTAGA
ACATAAAATTTGAGACGCACAGTCTCTTGAAAATTTGTTTAAAGTATATGTAACGGTTCG
TGAATTGTCCTCCCAATATTACTCAGGGGACTTCACCTTTATATTGGTTTCTGACAATGT
TTAGCAATTGAAAGACTTGATTGGTGGAACTGATCAAGAACATGTGTGATCTAATTCCTC
AATGGTTTGGTTTTGAGTACCTATTGACCTTAATGATCTCTTAGGGAAGTAACTTTCCAG
GGTGTTAGGAATGACAGCATGGAAGTGGGAGTGGCAAGAGGGATTCTGCTCAGTGGCATC
ATACATTAGACTTCTTATACTGTCTACTTAAAATTAACATGATTGTATGAACTGAAGGGA
TACAATTGCTCTCACATCTTGCTCTTTCCTTTTTAGGGAGGACCTTCTTCAAATTCAAGC
TAGGTCTCCCCTTATTCCACACAAGAACACTGTGCCCTTCACTGCAAGTGAGCATTCAAA
TTCTGAGGCAGTGTTGGCAGCCCAGGGAAGCCATGGTGCTGGTGAAATTACATTATTGAC
AGTTGTGTCCTGCCTGTGTCTGGGTCAATGATGACAACAGAAAGTCAAGAATAGGTTGAT
GACATAAAAATCATGCTCAATAAGATGACGCTGAGGTCCAACCAGGGAGCGAGGGTTACA
AGCAGACCTTTCTCATTGAGGACCACTTGCGGGACTCATCTGAGCTGCTCTGATTCCCTT
GTGCTCTTTTCCCTCTGTGGGAACCTGGACAATCTTAGTGCAACTGTGCTGGCAAACACT
GCCTGCCAACTAGCACCTAGTCTCATAATCTGCTTGTGTGCAAGTCTGCAACACCAACCC
TGTCATCATTACCCTCTCTGCTCTGATGTCTTGCAGTCATCTGGCATCTCCCCTGCAGTC
CAGTGGATCACTATTCCCAGGTGAGTGAAATCATCACGAATAATGGATTGAACTTCTTAT
AAGATCTTCCTCAGTATTTTGACCATTAATTTCAGGCCATCAAAGGTTTCTTAATTAAAA
ATAATGCAATACAATTCAGAAATGAATTGCAATTCTCAGTATGTTCTGTCCTTTTGAACT
GCACAATTAAAAATGTAGAGAAATTCCTTTCTACCTGTAGTTCATACAGCCATAAAATTG
AATTCCTTAGAAGAGAAACTAGATGATACTATCTACACAAAAGGAAGAATCTGGAATATG
AATATATCTTTTGAATTTCGAGAAATTTCAGTTCACACACAGGATCACAAATCCATGCTG
GTCATTGGAGAACGATTTCCAATGACAAGGGGACCCAGGCGTAAGACTTTAGTTTAGAGA
TGTAGAACTTGGCGATAAATTTCTGGCATCATAAGACACCCAAATTACTATTCCCCCAAA
GAGAGTCAGGCCAAATATTTCTCGAAACTCTCAGGCCACAGGGAATCTAGCCAGTACCGC
AGCTGGAAGTTGCAGGTGTGGCTTTGGCCACCAATTACCTTCCATGTTTCCTCACACTTC
TTCATCCTTGATCTTACTAAAGTTTATTTCAGTATTCATCAGAAAACAAATGCTATCAAG
AAGATGGTTTCTGGAGGGGTTGTGACAGAAGAACGTGATGTCACAGGAATACTTGCAAAC
TCCAACTGATCTAGTCACAGGAATTTTGGTCACATTCTCAGTTTTGTCACATGGCAATCA
CTGAGTGCTAACACTCAGGGTTTCATGGCAGAAATACTTGTTGCTTTCTTCTGGGCAACT
GATTCTCTTCAGCATTCACTTAGCAGCTGTGGGAACTGATTGTTACCATGCAGTATTGAA
CTGGGGAGGAATGAACATAGCCTAGCACATAAAATCTGAAATGCACAAGTCTCATGAAAA
TTTGATTAAAGTATACGTAACTGTTCGTGTATTGTCCTTCCATTATTACTCAGGTAAATT
CACCTTTGCCTTGGTTTCTGACAATGTTTAGAAATTGAAAGATTTGATCGGTGTATATGA
TCAAGAGCATGTGTCATCCCCTTCATCAATGATTTGGTTTTGGGTACCTATTGACCTATT
GATCGCTTAGGGAAGTAACTTTCCATGTGTTGGGAATGTCAGCATGGAAGTGGATGTTGC
AAGAGTGATTCTGCTAAGTGGCCTCATACATTAGACTTCTTAAACAGCCTCCTTAAAATT
AATATGATTGTATGAACTGAAGGGATACAATTGCCCTAACATCCTGCCCTTTCCTTTTTA
GAGAGGACAGTCTTCATTTTAAGTTAGGTCTCCCCATTTTCCACATAAGAGTGCTGTGCC
CTTGTATCCTCTGCACTTGCAAGTGGGGATTCAAATTCTGAGGCAGTGTTGGCAGCCCAG
GGAAGCCATGGTACTGGTGAAATTAAATTAGTGACAGTTGTGTCCTGCCTGTGTCAGGGT
TAATGATGACAACAGAAAGTCAAGAACAGGATGATGACATAAAAATCATGCGCAATAGGA
TTACGCTGAGGCCCATCCAGGTAACCAGGGTTACAAGCACTACTTAGTCTCTTTGAGGAC
CACTTGCAGGACTCATCTGAGCTGCTCTGATGACCTTGTGCTCTTTCCCCTCTGTGGGAA
CCTGGACAATCTTAGTGCATGTGTGCTGGCAAACACTGTCAGCCAACTAGCACCAAGTCT
CATAATCTGCTTGTGTGCAAGTCTGCAACACCAACCCCGTCATCATTACCCTCTCTGTTC
TGATGTCATACAGTCATCTGGCATCACCCCTGCAGTCCAGTGGAGCACTATTCCCAGGTG
AGTCAAATGATCACTAATAATGTATTGAACTCCTTATAAGATCTTCCTCAGTATTTTGAC
CAATAATTTCAGCCCATCAAAGGATTCTTATTGAAAAATAATGCAATACAAGTCAGAAAT
GAATTTCACTTCTCAGTATGTTCTGTCCATTTGAACTGCAAAATTAGAAATGTAGAGAAA
TTCCTTTCTTCATGTAGTTTATAAAGCCAAATAATTGAATTTCTGGGAAGAGATCCTAGA
TGATACTATCTACACAAAAGGGGGGATCTGGAATATGAATAGACCTTTTGAATTTGGAGA
AATTTCAGTCCACAAACAGGCTCACAAATCCAAGCTGGAACACATCAATCTATTTCCAAT
GACAAGGGGAACCCCGGCTTAAGACATTAGTTTAGAAATGTAGAAAATGGCGATAAATTT
CCCGCATCAAAAGACACTCCAAGAATTATTCCCAAATAGATTGGAGAAATTTTTCACGAA
ACTCTCAGGCCACAGCGAACCTGGCCAGTACTGGAGCTTCAAGTTGCAGGTGTGGCTTTG
GCTACCAATTCCCTTCCATGTGTCCTCACACTGCTTAGTCCTTGATCTTACTAAAGTTTA
CTTCAGTATTCATCAGAAAACGAATGCTATCAAGGAGATGGTTTCTGGAGCTCTTGGGAC
AGAGGAACGTGATGTCAATGGGATACTTGCAAACACCAACTGATCTAGTCACACGAATTT
TGGTCCCATTCTCAGTTTTGTCACATGCCAATCACTGAGTATTAACATTCAGGGATTCAT
GGCTGAAATTCTTGTGGCTTTCTTCTGGGCAACTGATTCTCTTCAACATTCACTTACCAG
CTGTGGGAACTGATTGTTACCATGCAGTATGGAAATGGGGAGGAATGAACATAGCCTAGC
ACATAAAATTTGAAATGCACAAGTCTCTTGAAAATTTGTTTAAAGTATATGTAACTGTTC
GTGTATTGTCCTCCCCATATTACTCAGGGAACCTCACCTTTTTCTTGGTTTCTGATAATG
TTTAGCAATTGACAGATTTGATCGGTGTAACTCATCAAGAGAATGTGTGATCCCCTTCAT
CAATGGTTTGGTTTTGTGTACATATTGACCTAATGATCTCTTAGGGAAGAAACTTTGCAG
GGTGTTGGGAATGTCAGCATGGAAGTGGGAGCTGAAGGAGGGATTCTGCTCAGTGGCATC
ATACATTAGACTTCTTACACAGTGTCCTTAAAATTAACGTGATTGTATGAACTGAAGGGA
TACAATTGCCCTCACATCTTTCTCTTTGCTTTTTAGAGAGGACAGTTTTCAAATTCAAGC
TAGGTCTCTCCTTATTCCACACAAGAGCGCTGTGCCCTTGTATCCTCTGCACTTGCAAGT
GAGGATTCTAATTGTGAGGCAGTGTTGGCAGCCAGGTAATTCATGGTGCTGGTGAAATTA
AATTAGTGACAGTTGTGTCCTGCCTGTGTCTGGGTCAATGATGACAACAGAATGTCAAGA
ACATGATGACATAAAAATCATGCTCAATAGAATTAGGCTGAGGCCCAACCAGGGAGCCAG
GGTTACAAGCAGTCCATTCTCTTTGAGGACCACTTGTGGGACTCCTCTGAGCTGCTCAGA
TGCCCTTGTGCTCTTTCCCCTCTGTGGGAACCTGGACAATTTCAGTGCATGTGAGCTGAC
AAACACTGCCTGCCAACTAGCACCTAGTGTCATAATCTGCTTTGTGCAAGTCTGCAACAT
AAACCCCTTCATCATTACCCTCTCTTCTCTGATGTCTTGCAGTCATCTGGAATCACCCCT
GCGGTCCAGTGGATCACTATTCCAAGGTGAGTGAAATAATCAGGAATAATGGATTGAACT
TCTTATAAGATATTCCTCAGTATTTTGACCATTAATTTCAGCCCATCAAAGGTTTCTTAA
TTAAAAATAATCTAATACAAGTCAGAAATGAATTGCAATTCTCAGTATGTACTATCCCTT
TGAACTGCACAATTAAAAATGTACAGAAATTCCTTTCTCCCTGTAGTTCAAACAGCCATA
AAATTGAATTTCTTGCAAGAGATCCTAGATGATACTGTCTTCACAAAAGGAGGGAACTGC
AATATGAATATACCTTTTGAATTTGGAGAAATTTCACTCCACACACAGGCAAACAAATCC
AAGCTGGTCCACAGAGATCAATTTCCAATGACAAGATGACACAGGCAAAAGATTTTAGTT
TAGAGATGTAGAACTTGGCGATAAATTTCCTACATCATATGACACCCCACGAATTATTCC
CTCAAAGAGAGCTTGGCGAAATTTTTCACGAAGCTCTCAGGCCACAGGGAACCTAGCCAG
TACTGGAGCTTGAAGTTGAAGGTGTGGCTTTGGCTACCAATTCCCTTCCATGTGTCCTCA
CACTGCTTCATCCTTGATCTTACTATAGTTTACTTCAGTATTTATAAGTAAACAAATTCT
ATCAAGAAGATGGTTTCTGGAGCGAGTGGGAGAGACGAATGTGATGTCACTGGAAAACTT
GCAAACACCAACTGATCTAGTTCAGTAATTTTGGTCACATTCTCAGTTTTATCACATGGC
AATCACTGAGTGCTAACGCTCAGGGATTCATGGCCAAAATACTTGTTGCTTACATCTGGC
CAACTGATCTCTTCAGCATTCACTTACGAGCTGTGGGAACTGATTGTTACCATGCAGTAT
GGAAATGGGGAGGAATGAACATAGCCTAGCACATAAAATTTGAAACGCACAAATCTCTTG
AAAATTTGTTTAAAGTATATTTAACGGTTCTGTATTGTCCTCCCAATATTACTAAGGGAA
CTTCAATTTTTTCTTGAATTCTGACAATGTTTAGCAATTGAAAGATTTGATCTGTGTATC
TGATCAAGAGCATATGTGATCCCCTTCGTCAATGGTTTGGTTTTGTGTACCTATTGACCT
TAATGATCTCTTAGAGAAGTAAATTTCCATGTTGCTGGAAATATCATCATGGAAGTGGGA
GCTGCAAGAGGGATTATGCTCAATGGAATCATACATTAGACTTCTTCTACAGTCTCCTTA
AAATTAACATGATTGTATGAACTGAAGGGATACAATTGCCCTCACATCTTGCTCTTTCCT
TTTTACAGAGGACAGTTCAAATCCGAGCTAGGTCTCCCCTTATTACACACAACTGCGCTG
TTCCCTTGTATCCTCTGCACTTGAAAGAGATGATTCAAATTCTGATGCAGTGTTGGCAGC
CCAGGTCAGCCATGGTGCTGGTGAATTAAATTAGTGACAGTTGTATCCTGCCTGTGTCTG
GGTCAATGATGACAACAGAAAGTCAAGAACAGGATGATGACATAAAAATCATGCTCAATA
GGATTAGGCTGAGGCACAACCAGGGAGCCATGGTTACAAACAGTCCTTTACCTTAGAGGA
CCACATGCGGGACACATTTGAGCTGCTGTGATGCCCTTGTCCCCATTCCCATCTGTGGGA
ACCTGGACAATATTAGTGCAAGTGTGCTGGCAAACACTGCCATCCAACTAACACCTAGTC
TCATAATCTGCTTGTGTGCAAGTCTGCAACAATATACCCTTCAACATTACCCTATCCTCT
TTGATGTCTTGCAGTCATCTGGCATCACCCCTGCAGTCCAGTGGCTCACTTTTCCCAGGT
GGGTGAATTGATCACGAATAATGGATTGAACTTCTTATAAGATATTCCTCAATATTTTGA
CCATTAATTTCAGCCCAACAAAGGTTTCTTAATTAAAAATAATGCAATACAAGTCAGAAA
TGAATTGCAATTCTCAGTATGTTCTGTCCCTTTGAACTGCACAATTAAAAATGTAGAGAA
ATTCCTATCTATATGTAGTTCATACAGTCATAAAATTGAATTTCTTGGATGACATCCTAG
TTGATACTATCTACACAAATGGAGGGATATGGAATATGAATATACCTTTTGAATTTGGAT
AAATTTCAGTCCACACACAGGCTCATAAATCCAAGCTGGTCCACAGAGATCGATTTCCAA
TGACAAAGGGAAACCAGGCGTAAGATTTTGGTTTGGAGATGTAGATATTGGCAATAAATT
TCCTGCACCAAAAGTTACTCCACAATTATTCCCCCAAAGGGAGCTTGGCGAAATTTTTCA
CGAAACTCTCAGGCCACAGGGAACCCTGCCATTACCATAGCTTGAAGTTGAAGGAATGGC
TTTGGCTACCAATTCCCTTCCATGTGTCCTCACACTGCTGCATCCAATATCTTACTAAAG
TTTACTTCAGTATTCATTAGAAAACAAATCCTATCCAAGAGATGGCTTCTGGAGTGGTTG
GGACAAAGGAACTTGATGTCAGTGGAATACTTGCAAATACCAACTGATCTAGTCACAAGA
ATTTTGGTCCCATTCTCAGTTTTGTCACATGGTAATCACTGAATGCTAACACTCGGGGTT
TCAGGGCAGAAATACTTGTCGCTCTCTTCTGGGCAACTGATTCTCTTCAGCATTCACTTA
CCAGCTGTGGGAACAGATTGGTACCATGCAGTATGGAAATGGGGAGGAATGAACATAGCC
TAGCACATAAAATTTGCAACGCACAAGTCTCTTGAAAATTTGTTTAAAGGATATGTAATG
GTTCGTGTATTGTCCTCCTCATATTACTCAGGGAACTTCATCTTTTTCTTGGTTTCTGAC
AATGTTTAGCAATTGAGAGATTTGATAGGTGTAACTGATCAAGAGCATGTGTGATCCCCT
TCATCAATGGTTTGGTTTTGGGTACATATTGACCTTAATGATCTCTTTGAAAGTAAATTT
CCATGTTGGTGGGAATGTCAGTATGGAAGAGGGACTGAAGAAGTGATTCTACTCAGTGGC
ATCATACATTAGACTTCTTAAAGAGTCTCCTTAAAATTAACATGATTGTATGAACTGAAG
GGATACAATTGCCCTCACATCTTGCTCTTTCCTTTTTAAAGAGGACAGTCTTAAATTCAA
GATAGATATCCCCTTATATGGCACAAGTGCACTGTGCCCTTGTATCCTCTGCACATGCAC
GTGTGGATTCATTCTGAGGCAGTGTTGGCAGCCCAAGTAAGACATGGTGCTGGTGAAATT
AAATTAGTGACAGTTATGACCTGCCTGTGTCTGGGTCAATGATGACAACAGAAAGTCAAG
AACAGGATTTCAGCCCATCAAAGGTTTCTTAATTAAAAATAATGCAATACCAGTCAGAAA
TGAATTTCACTTCTCAGTATGTTCTGTCCCTTTGAACTGCACTATTAAAAATGTAGATAA
TTTCCTTTCTACCTGTAGTTCATACAGCCATAAAATTGAATTTCTTGGAAGAGATCCTAG
ATGATACTGTCTACACATGGAGGGATCTGGAATATGAACATACCTTTTGAATTTCGAGAA
ATTTCAGTCCACACACAGGCTCACAAATCCAAACTGGTGCACAGAGATCGTTTTCCAATG
GCAAGGCGAACCCAGGAAGAAGACTTTAGTTTAAAGTTGTAGAAATTGGTGATAAATTTT
CTGCATCAGAAGACACTCCAAGAATTATTCCCCCAAAGAGAGCTTGGCAAAATTTTTCAC
GTAACTCTCAGAACACAGGGAACCTAGCCAGTACGGGAGATTGAAGTTGAAGGTGTGGCT
TTGTCTACCAATACCCTTCCATGTATACTCACACTGCTTCATCCTTGATCTTACTAAAGT
TTACTTCAGTATTCATCAGAAAAGAAATGCTATCAAGGAGATGGTTTTTGGAGTTGTTGG
GGCAGAAGAACGTGATGTCAATGGGATACTTGCAAACACCAACTGATCCAGTCACACGAA
TTTTGGTCACATTCTCAGTTTGATCACATGGCAATCACTGAGTGCTAACGCTCAGGGATT
CATGGCCAAAATACTTCTCTCTTTCTTCTGGGTACTGATTCCCTTCAGCATTCACTGACC
AGGTGTGGGAACTGATTGTTACCATGCAGTATGGAAATGGGGAGGAATGAACATAGCCTA
GCACATAAAATTTGAAACGCACAAGTCTCATGAAAATTTGATTAAAGTATATGTAACTGT
TCGTGTATTGTCCTTCCAATATTACTCAGGGAACTTGACCTTTGCCTTGGTTTCTGACAA
TGTTTAGATATTGAAAGATTTGATCGGTGTATATGATAAAGAGCATGTGTCATCCCCTTC
ATCAATGATTTGGTTTTGGGTACCTATTGACCTATTGATCTCTTAGGGAAGTAACTTTCA
AGGGTGTTGGGAATGTCAGCATGGAAAAGGGACTGAAGAAAGGATTCTACTCAGTGGCAT
CATACATTAGACTTCTTAAACAGTCTCCTTAAAATTAACATGATTGTATGAACTGAGGGA
TACAATTGCCCTCACATCTTGCTCTTTCCTTTTTAGAGAGGACAGTCTTCAAATTCAAGC
TAGGTCTCCCCTTATTCCACACAAGAGCGCTGTGCCCTTGTATCCTCTGCACTTTCAAGT
GAGGATTCAAATTCAGAGGCAGTGTTGGTAGCCCAGGTAAGCCATGGTGCAGGTTAAATT
ACATTATTGACAGTTGTGTCCTGCCTGTGTCTGGGTCAATGATGACAACAGAAAGTCAAT
TACAGAATGATGACATAAATATCATGCTCAATAGGATTCTGCTGAGGCCCAAGCAGGGAG
CCAGGGTTACAAGCACTACTTTGTCTCTTTGAGGACCACTTGTGGGACTCATCTGAGCTG
CTCTGATGCCCTTGTGCTCTTTCCCTTCTGTGGGAAACTGGACAATCTTAGTGCAACCGT
ACTGGCAAACACTGCATGCCAACTAGCACCTAGTCTCATAATCTGCTTGTGTGCAAGTCT
GCAACACAAACCCCATCATATTACCCTCTCTGCTCTGATGTCTTGGAGTCACCTGGCATC
ACCCCTGCGGTCCAGTGGATCACTATTCCCAGGTGAGTGAAATGATCACGATTAATGGAT
TGAACTTCTTATAAGATTTTCCTAAGTATTTTGACCAATAATTTCAGCCCATCAAAGGTT
TCTTAATTAAAAATAATGCAATACCAGTCAGAAATGAATTTCACTTCTCAGTATGTTCTG
TCCCATTGAACTGCACAATTAAAATGTAGAGAAATTCCAGTCTACCTGTAATTCATACAG
CCAGAAAATTGAATTTCTTTGAAGAGATCCTAGATAATAATGTCTACACAAAGGAGAGAT
CTGGAATATGATTATACCTTTTGAATTTCGAGATATTTCAGTCCACACAAAGGCTCACAA
ACCCAAGCTGGTGCACAGAGATCGATTTCCAATGGCAAGGGGAACCTAGGAATAAGACCA
TAGTTTAGAGATGTAGAAATTGGGGACAAATTTTCTGCATCAAAAGACACACCAAGGATT
GTTCCCCCTAAGAGAACTTGGTGAAATTTTGGACGTAACTCTCAGGTCACAGGGAACCTA
GCCAGTACGGGAGATTGAAGTTGATGGTGTGGCAATGGCTACCAATTCCCTTCCATGTAT
ACTCACACTGCTTCATCATTGATCTTACTAAAGTTTACTTCAGTATTCATCAGAAAACAA
ATGCTATCAAGGAGATTGTTTTTGGAACTGTTGGGGCAGAAGATTGTAATGTCAATGGGA
TACTTGCAAACACCAACTGATCTAGTCACATAAATTTTGGTCACAGTCTCAGTTGATCAC
ATGGCAATCACTGAGTGCTAACGCTCAGGGATTCATGGCCAAAATACATGTCGCTTTCTT
CTGTGTACTGATTCTCTTCAGCATTCCCTTACCAGCTGTGGGAACTGATTGTTACCATGC
AGTTTGGAAATGGGGAGGAATGAACATAGCCTAGCACATAAAATCTGAAATGCACAAGTC
TCATGAAAATTTGATTAAAGTATATGTAACTGTTCGTGTATTGTCCTTCCAATATTACTC
AGGGACCTTGACCTTTGCCTTGGTTTCTGACAATGTTTTGCAATTGAAAGATTTGATCGG
TGTATATGACAAAGAGCATGTGTCATCCCCTTCATCAATGATTTGGTTTTGCGTACCTAT
TGACCTATTGATCGCTTAGGGAAGTAACTTTCCATGTGTTGGGAATGTCAGCATGGAAGT
GGATGTTGCAAGAGGGATTCTGCTAAGTGGCATCATACATTAGACTTCTTAAACAGCCTC
CTTAAAATTAATATGATTGTATGAACTGAAGGGATACAATTGCCCTCACATCTTGCTCTT
TCTTTTTAGAGAGGACAGTCTTCAAATTCAAGCTAGGTCTCCCCTTATTCCACAAGAGAG
CGCTGTGCCCTTGCATCCTCTGCACTTGCAAGTGAGGATTCAAATTCTGAGGCATTGTTG
GCAGCCCAAGTAAGTCATGGTGCAGGTGAAATTACATTATTGACAGTTGTGACCTGCCTG
TGTCTGGGTCAATGATGACAACATTAAGTCAATTACAGAATGATGACATAAAAATCATGC
TCAATAGGATTACGCTGAGGCCCAAGCAGGGAGCCAGGGTTACAAGCACTACTTAGTCTC
TTTGAGGACCACTTGCGGGCCTCATCTGAGCTGCTCTGATGACCTTGTGCTCTTTTCCCT
CTGTGGGAACCTGGACAATCTTAGTGCAACTGTGCTGGCAAACACTGCCTGCCAACTAGC
ACCTAATCTCATAATCTGCTTGTGTGCAAGTCTGCAACACCAACCCTGTCATCATTACCC
TCTCTGCTCTGATGTCTTGCAGTCACCTGGCATCACCCCTGCGGTCCAGTGGATCACTAT
TCCCAGGTGAGTGAAATGATCACGATTAATGGATTGAAATTCCTATAAGATATTCCTCAG
TATTTTGACCAATAATTTCAGCCCATCAAAGGTTTCTTAATTAAAAATAATGCAATCCCA
GTCAGAAATGAATTTCACTTCTCAGTATGTTTTGTCCCTTTGAACTGCACTATTAAAAAT
GTAGAGAAGTTCCTTTCTACCTGTAGTTCATACAGCCATAAAATTGAATATCTTGGAAGA
GATCCTAGATGATACTATCTACACAAATGGAGGGATCTGGAATATGAATATACCTTTTGA
ATTTGGAGAAATTTCAGTCCACACACAGGCTCACAAATCAAAGCTGGTGCACAGAGATGG
ATTTCCAATGGCAAGGGGAACCCAGGAATAAGACTTTAGTTTAGAGATGAAGAAATTGGC
GATAAATTTTCTGCATCAAAAGACACTCCAAGAATTATTGCCCCAAAGGGAGCTTCGCGA
AATTTTTCACGAAACTCTCAGGCTACAGGGAACCTAGCCAGTAGGGTAGATTGAAGTTGA
AGGTGTGGCTTTGGCTACCAATTCCCTTCTATGTGTCATCACACAGCTTCATTCTTGAAA
TTACTAAAATTTACTTCAGTATTCATCAGAAAACAAATGCTATCAAGGAGATGGTTTCTG
GAGCTCTTGGTACAGAGGAACGTGATGTCAATGGGATAATTGCAAACACCAACTGATCTA
GTCACACGAATTTTGGTCACATTCTGAGTTTCATCACATGGCAATCACTGAGTGCTAACG
CTCAGGGATTCATGGCCAAAATACCTGTTGCTTTCTTCTGGGCAACAGATTCTCTTCAGC
ATTCACTTACCAGCTGTGGGAACTGATTGTTACCATGCAGTATGGAAATGGGGAGGAATG
AACATAGCCTAGCACATAAAATCTGAAATGCACAAGTCTCATGAAAATTTGATTAAAGTA
TACGTAACTGTTCGTGTATTGTCCTTCCAATATTACTCAGGTAAATTCACCTTTGCCTTG
GTTTCTGACAATGTTTAGCAATTGAAAGATTTGATCGGTGTATATGACAAAGAGCATGTG
TCATCCCCTTCATCAATGATTTGGTTTTGGGTACCTATTGACCTATTGATCGCTTAGGGA
AGTAACTTTCCATGTGTTGGGAATGTCAGCATGGAAGTGGATGTTGCAAGAGTGATTCTG
CTAAGTGGCATCATACATTAGACTTCTTAAACAGCCTCCTTAAAATTAATATGATTGTAT
GAACTGAAGGGATACAATTGCCATCACATCTTGCTCTTTCCTTTTTACAGAGGACAGTCT
TCAAATTCAAGCTAGGTCTACCCTTATTCCACACAAGAGCGCTGTGCCCTTGTACCCTCT
GCACTTGCAAGTGAGGATTCAAATTCTGAGGCAGTGTTGGCAGCCAAGGTAAGCAATGGT
GCAGGTGAAATTACATTATTGACAGTTGTGTCCTACCTGTGTCTGGGTCAATGATGACAA
CAGAAAGTCAAGAACAGAATGATGACATAAAAATCATGCTCAATAGGATTACGCTGAGGC
CCAACCAGGGAGCCAGGGTAACAAGCACTACTTAGTCTCTTTGAGGACCACTTGCGGGAC
TCATCTGAGCTGCTCTGATGACCTTGTGCTCTTTTCCCTCTGTGGGAACCTGGACAATCT
TAGTGCAACTGTGCTGGCAAACACTGCCTGCCAACTAGCACCTAATCTCATAATCTGCTT
GTGTGCAAGTCTGCAACACCAACCCTGTCATCATTACCCTCTCTGCTCTGATGTCTTGCA
GTCACCTGGCATCACCCCTGCGGTCCAGTGGATCACTATTCCCAGGTGAGTGAAATGATC
ACGATTAATGGATTGAAATTCCTATAAGATATTCCTCAGTATTTTGACCAATAATTTCAG
CCCATCAAAGGTTTCTTAATTAAAAATAATGCAATCCCAGTCAGAAATGAATTTCACTTC
TCAGTATGTTTTGTCCCTTTGAACTGCACTATTAAAAATGTAGAGAAGTTCCTTTCTACC
TGTAGTTCATACAGCCATAAAATTGAATACCTTGGAAGAGATACTAGATGATACTATCTA
CACAAATGGAGGGATCAGGAATATGAATATACCTTTTGAATTTGGAGAAATTTCAGTCCA
CACACAGGCTCACAAATCAAAGCTGGTGCACAGAGATGGATTTCCAATGACAAGGGGAAC
CCAGGAATAAGACTTTAGTTTAGAGATGAAGAAATTGGCGATAAATTTTCTGCATCAAAA
GACACTCCGAGAATTATTGCCCCAAAGGGAGCTTCGCAAATTTTTCACGAAACTCTCAGG
CCACAGGGAACCTAGCCAGTAGGGTAGATTGAAGTTGAAGGTGTGGCTTTGGCTACCAAT
TCCCTTCTATGTGTCATCACACAGCTTCATTCTTGATCTTACTAAAATTTACTTCAGTAT
TCATCAGAAAACAAATGCTATCAAGGAGATGGTTTCTGGAGCTCTTGGGACAGAGGAACG
TGATGTCAATGGGATACTTGCAAACACCAACTGATCTAGTCA
  Untranslated Region
  Coding Sequence
  snoRNA
NC_005100
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved