Rattus_norvegicus Locus Poly:3:SNORA71
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Poly:3:SNORA71
Rattus_norvegicus
Poly:3:SNORA71
3
SNORA71, SNORA71, SNORA71
1001..1132, 2546..2671, 4424..4553
5553
GCAGCAAGGGGAAACCCGGGTGCCTCTAAATGGTCTTCCCATGGGCACCAGCAGAGGGG
TAGTGTGGAGTTGTGGTTTGAGAAAAGCTGACGAAGCCACTGGGCAGCGAGAAGCCCAGT
AGGAGCCAGAAGTACCCAAGAGCAAGACTAGGTACAGTTTGGGTCCATGTTGCATAATGG
GAGCCCCTTACAGATTACAGAGGAAAGGGGGTTGGGGTGGGGTCCATGCCACGTGGTTTG
CTGCCTGGCAGCTTCTGTGTCTGGTATTCTGTGTGCTTCCCAGGTAAGCTCACCTGGGCT
AATCTTTTGCAGAAATAATAGCTTGGATCTACAGTGGCCATAAAGTTGGCTCCAACCCAC
TAGACTGACAAGACTACGGTGCTCCTGAGTGAGGATTGTGCCCTGGGATCTGGGGTGCAG
TTTCTTCAGTTACATATGTGAAGGTAAGGTAAGGCTGGGGGCTTTGAGGTGTGCCTGCTT
CTTGCTGTACCCACTTGGGATCTATGTCTCTTGTGTTGTATGTTCCCGCCCGTCCCTTCT
GTGCCCCTCTGCTTTACTTTGGGGGGTTGAGAGCAGAATGGAAAGGAACTGGGAGGATTT
GGGGGTCATACACAGCCTCCAGATCTCCAGTCACTGCTCTCTGCTCACTTCCGGGCCTTT
TCTGGTTCTTGGTTTCCTCTTCTGGAAAATGGGACTACCAGTTCCTCCCTCTGTGACGTA
AGAGGTCTGTCACCCTTCAGCTCTGCTGGCTAGGCTGGTTGTGTTTACCTAAGACGTGAC
AGCAAGTGCTGGGGCTACTGTAGGTCTAGCGCTCACTAGAATTGTCACCTCCTCCCAGCC
AGTCTTCTGAGCTCCCCTTCAGGAACAACTCTTGCTCAGTTCGGAGCAGCTCCCTTCCTC
TGTTGGCTATCTGTCTGTTGCCTGTCTGTCTGTCTCTAATTTAACCATTACCCAGCCCGT
TGGCCATAGCCTTCCCTCTCCTCTTGCCCTCTGCTCTTTGCCCCTGTATTCGAAAGTGAT
TGTGGGCTGCCGGTGCCCTGGTCATTGATACTGCAGGGAGAGGATGCGGAAAGCCTTTCC
CCGTGTTTGGAGGACCCACACTTATCCTTGCCAAACCCTGGTGCTTTCCCACATCGCCCG
CTGCCTGTCCTTCTGGCTCTTCTGTGAAGCCGTGGTATGGAGCTCAGACGTTGGCTGCTT
CCTGCAGAAGCTTTCTCGGCCTCTACACCCAGTTGTCACCTCTTCAGGACGCTTGAGAAC
CTGTAGAAAATGTTGCCTTGCTTGACTTCTAGCATGCTGTTTGCTGTGTTCCATTAGTCA
AGAGTCGGGGTTTTGATTGAACAAATGACCGGCAAAGGGACAGTCACTGTACAGCATTGC
CACGTGTAAACTGAGTTAACACCCTGACAGGGAGGCCCAGGAGGGAGCAGACGTGCTGTG
TTCCCTCCTTGAATTCTTCTCTTGTGCTTACTTTCGATCCTTGCCTTGAGTAGCCACTTG
GGAAGGGTGTTTCTCTCCACCCTGTGACAACAGGCAAGAATGAGGGCCTGACAGCACAGA
GTAACTGATGTGTCTGTGCTGTTCTTACATACCAGTGCCAGGAGAGACGGCACACTCCAG
AGTGCCGTGTCCTGACGCGCCTTTGAGCAGCCAGCACAGCAGATCATCAGACCCGTCTCC
AGAGAGCTCTGGTTCCTCCTCCAGAACAGACTGGCTGCTCAGGAGGCCATAGCAGGTAAG
TCACGTGCTTGCCACCGTTCAGAGACCTGGTCAAGGGATCAGAGTTTGAAAGATTGTAAG
GATGACTCTGTCCAGTCCGGAGCCCCAGCCTTTGAGTCTCTGGAGTTTCGTAGTTTTCTC
TGCTGTTCTGGTGGCACTTCGAGGGAGGTGAGGATGAGTAGGGAGTGGTGTGTGGATCCT
CCCACTTCCCTGGGAGACCTAGGTCATACATGACACCTTCAGATACCTGCTAGGGGTAAG
TGTGAGGCTTTTCCAGTGTTAGCGAATTGTAAGGGCAAGGGGTGGATGTAGGCATTAGAA
ATACCTCTATATGCCACCATTTTCCCCCGGCCTTTATCTTTGTCATTGTGTTGGGTAGCA
GTGACTTGTTAGCAGTAGAAGGAATATTCATAGCTGGACGATAAGAGAAAGGTTGGGTGG
TCTGGAGCGTCTGCACTGGCTTCCTGAGGTACCGTCCCCCAGCATCACAGCAGAACCCAT
CCCCCCCCACCCTCCCCCCCCAACTGGGGACAGAAGTGCACACACTGGAAAGCAGGGGCT
CACCCTTGAGCTCCCATCAAGTGACCAGCTGATACCTAGCTTGTCCCCAGATTCTACCCT
AAGCAGTCTTACCTTGAACCTCCATTTCCTGGCTTGGAAAACCAAAGCTAAGACAGATTT
TCAGGACTGACTCTCCCTGATTCTTGGAGATTGGTGTGGTTCTGTGCAGTTGATATTAGG
CACGGAATCCACATGTTCACCGTAGCTTGCATCCGGCCCTGGCCTCGTCTCCTGTCTTTC
ATAAGTTTCCTTTTGTTTTTTTCTGCCCCTGCATCCGAAAGTGATCTTGGCTGCCTGTGC
CCTGGTCATTGGTAGTGCAGGGAAATCATGCCGAAAGACGTGTTCTGAGTTCGGTCTATC
CTGACCCCTCCAAATCCTAGAGCTTTCCTACACTCGTGCCTTTCTCTGCAGCCTTATAAA
AGTGTAGTGCTTTCTGGAAGCTCAAGTCGGTGCTGGGACTTTGCAACTTGGTGTTCTGTT
TCCAGAAACTTGGGGTATTTGCATGTTGTGAGGTGATAGGTCAGCACAGATTTCCAAAGG
GCCTCTAGACAGGTTCCTTAAGTTTTCACATAGGAACAGAGGGGAGATGACAGGAGGAAA
TGAGGGGCTGGAGCGAGTAGAGCTGTGTGCGGGGTTGGGGGGTGATGGTGAGGTAGGGTG
TGTGTAACAGAATCCTTAAGCCTGTGCTTAGAGAAGGAGCTCCCTGGTACAGAATGCGCA
GCTCACTTCCTAACCTTGTGGTCCCTCATGGCCTGACGTATGTATTTGCAGCACTGTGAG
CCACTGGTCTTGGCCATCTGTGCTGCCAATTGTCTGGCCCTTTGGAGCTTTCTTTAAAGT
ACATGGCTTGTGGGTTCGGTCCCCAGCTCCGAAAAAAAGAACCAAAAAAAAAAAAAAAAA
GTACATGGCTTGCAGACCAAAATGCAGTCTGACATTTTTTATTTCGTGTGTGTGTATGTA
TGTATGTGTACCATGTGTGTATACCATGTGTGTGCCTAGTGCCCATGAAGAGTTTATTGG
GAGCTTAAGAGTTTCAGAGGGTGAGTCTATTCATGGCCAGTATGGCTTCAGGCATGGCCA
TATTGGAGCAGTAGCTGAGAGCTCACATCTTAATACAACCACCAGGCAGAGAGCTAACTG
ATCCCAGTTAGCTTTTGAAACCTCAAAGCTCTCCTACCCCACCCCCATGACACCTCCTCT
AACAAGGCCACCCTTCCTAATCGTCCCAAGCAGTTCTATCAACTAGGGACCATGTATTCA
GATATATGAGCCTATGGGCGGGGTCATTCTCATTCAAGCCTCCACTCATATCCAGACTGC
TTCTTCACAAAACTTAACAAAAGCAGAAAAGCCGACCATTATCAGAAGCTACAATGAAAT
AAATAAACCCATGAAGACTCATAGCCTTCACCTGTGGAGGACGTGAGCAATCAGAAGGAA
GAGAATGGAAGTGGGGGGCTGGGGTGTGCTAAGGGTGTGGCCTTGAGTGCCCAGCAGGAG
GAAAGAGGGTTCCAGGAAGAAGGTGTTGCAGCCACCTTTTGTCCCACCCACCCCCAACTG
ATATTTGTGTCTTGGTTCCTGTTGAAGTCTTGGTTGTCTATGGGGTCCTGAGTGTGGCTT
GTCTCTGCAGGACTGTCAGTTGATCTCTGCCACGTGTGCTCAACAGTCGTGTGCTCAACA
GTCGTTGACTTTCCAGAAGAGGCTGGAACAGGGCCCTTGAAGGTATGAATCCAGACGCCT
CACGAGAGAGAGAGCTGCTGTGGTCCGGCAAAGGCCACAGTCATAAGAGAGAGAGAGCTG
CTGTGGTCCGGCAAAGGCCACAGTCATAAGGAAAAGCAGAGGCTGCTTCCCCACCCAGGC
CGGCAGGGACGTGTCGGTTAGTGAGTCCTCAGAAGTACCCCCAAACTTGTCTGTTTCATT
GATTGTCTTAGTAAAAGGCCACTAAAGCAGCACTACACCGTCGCTTGGCGTGTGTAGGGT
GATCATGCCTGCAGGCAGTAGTATGACAGCTCGTGTTGGAGAAGCTTGGAGAATTGGAAG
CTGCCTCTGTCAGAAGCTGTAGATGTGGTCACTGTTCCTGGTCACTTATCCCAGCTTGGC
CCTTTGCTAAGCTGTCCACCTATCCATTGTGGTTTCCAGTCTGTCCCTGTATTCGAAAGT
GATTATGGGCTGCCCGTGCCCCGGTCATTGATACTGCAGGGAGAGGATACGGAAAGCCTT
TTCCCCGTGTTTGGAAGGTCTCCTGTCCTTACCAAACCCTGGTGCTTTCGAACAAATCTT
CTCAGCCTATTGGTCTCTTGGCTGCTGATACCTGGCTCACTGAGTGTCCTCTATGAGTGC
TGGCCAGTGTCCTCAGAGGCTTCTGTAAGGGAGATAGAAGCCAGCCTCTGCCTTGAGGGT
TTTATTCTGGATCAGTTTTGCAAATATCTCATGAGCCCCAGTCATACTCTCCTTCCATGG
CTGCAGACGAGAGGCCTGCAGAAGCCTGTTTGGTGGAAGGCTAGCGTGTTCCCACATGCA
GTCAGGAGAAGAATAACTTGGCTGACAGGGACTCTGGTCTCTTGAGCCTGTCTAGCTCTG
ACCTGTCACAAGCTTCCAATTAGCTAACAGTGCCAGAAGCTATGTGATGCTACGGGTGGA
GATCTAAAGCCTCATGTTCTTTCTCTTTCTCATTTTATAGATGATTGTGGACACCAGAGG
GCCAGGAGTGGACAACAAAACCACAAAGTGACACTAGACCCTGCCTCTTCAGCATCATGA
AACAGCTTTTTACTGTGCTTAGTCATTGCCTCAAGCATGGGAGACTCCAGCATACACCAC
CTCTTCTGTCCCTGTGACCATCTGCTAGTGTCTGGAATGACTAATGGCTAGAACTTGTTG
CCAACTTCCTGTTACTTTCCCAACGGCTGTGCAATGAACCTCATAGGTTAATTCAGTCTG
GCTTTGAAATCCGTGTCAATTCATGAACTCAGGACTGGCTGTGGAAAAGGAAGGCCAGTT
CCTGTCACTCCTTGTGCCTTTCCTGTCCTTAATGCCCCCTGAGGCTTGGGCTTCAGGGTG
TTGGAAGTGAACTGTGAGGGCTGGTGCTGGTAGCCTATGGGCATTTAGGGTTGTGAGAGT
TGAGAGATTGCTGAAGACAAGGTCAGGACTTGGGGAAGGTGTCTGTCGGTAAGGAAGGCT
GGGGTGTCAGTTCTAGGAAGTGAAGTCTCACTACTGAAGTGAATGGGCAAAGGGACTGAG
AGAGAATTCAGAGCATCTTGCTGACAGGACAGAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved