Rattus_norvegicus Locus Mono:561:SNORA43
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Mono:561:SNORA43
Rattus_norvegicus
Mono:561:SNORA43
10
SNORA43
1017..1148
2148
TCTCACGCCTGCGTTAACGTTTGCGGTAGCTACCGTCGGGAGTACAGCTGCGATAGCTA
TACTCGCTCTCTTCCTCCTCCTCTTCCTCCTCCTCTTCCTCCCCCTCTTCCTCCTCCTCT
TCCTCCCCCCCTCTTCCTCTCCCTCCTCTTCCTCCCCTTCCTCCTCCTCCTTTTCCTCCT
CTTCTTCTCCTCCCCTTCCTCCTCCTCCTCTTCCTCCTCTCTTCTTCCTCCTCTCCCTCC
TCCTCCTCTACCTCCTCCTCTCCCTCCTCCTCTTCCTCCTCTTCCTCCTCCCCTCCTCCT
CCTCCCCCCTCCTCCCCCTTCTGTTCTTCTTCCTTCTTTCTCCTCCTCCATCTTTTTCTC
CTTCATCCTTCCCCCTCTCTTTCTTTTAAAAACATTTTTGGTTTATATGTATGAGTGCTT
TGCCTATGCACATATTATGAGCACCACATGCATGCCTGGTGTCTATGGAGACCAGAAGAG
AGTGTGTGATCCCTGGAACTGCAGTTACAAGCAGTTGTGAGTGTGAGAGTGCTGTGTGGG
TGCTGGGAAACAAATTCAAGTCCTTTGCTAGAGCAGTACGTGCTCTTAAACCACTGAGCT
ATGTCACTAGTCCTCTCCTCCTCCTCCTCCTCCTCCCCCAACTCCTCCTCCTCCTCCTCT
TCTTCCTCCTCTTCTTTTTCTTTGGTCAGTACTAGTATTTAACTTAGGGCCTCATATGTG
CTATGCAAATGTCCTTCTGCTAAATTATAAAGTCAATTTTCTATCTTACCTTTTTCTTCT
TTGTTTTCTCTCTGTTTTTCCTTTGGGGGACATGTGTTTTGTTTTATACAGGGTTTCTCT
GTGTAGTCCTGGGTGTCCTGGAACTTAGTCTGTAGACCAGGCTACCCCTGAATTTACAGA
GATCCACTTGCTTCTGCCTCCTAAGTGCTGGGATTAAAGGTGTGGGCCACCATGCCTGGG
TTGTTTTGTGTTTCTTTGTTTGTTTTTAGCTAAGATTTATTTTTGTCCTGTGTCTGTCAG
CACCACAGGCACAGCACAGCTGCTTAGCTGTGTCTGTCACATCAGGGCTGGGGGCAAGTG
GCTATTTCTGCACTCAGTGTTCAGAAGCCAGTAAGCACTGAATAGTGTTTGGCTGATAGC
CTCACATTTTGCCGACTGTGGTGAGATGGCACTGTGGTTTGACTTGGATGCTGTTGACCA
GACCTCAATGTCAGGGAATTCAAGGACTCACCTGAGGTGGTCTAGTCAGCATTTTAGCAA
GATGCAACTTTGGAATGGGAGAAGTGTGGAGTTTTCTGGGGGACCTTCAGAGAGGCCAGG
AAAATACAAGAAACGGTCAACCTTCTTTTGTTTTCCGAATCTGGGGAGGATAGAGGTGAC
CTCTTGGCCATGTGGCTGGTTAGAACAGTGCAGCTGTGATTTAAGGCCATGGGACTCAGC
TGTGACCGCTCTAACCTCACCAGGAACCTGCTGAGTCACCCAATGGGCAGTTCTCATCCC
AAGAACCCACATCCTAAATTCTGAACCATATTTGGGTTTGCTAGGGTTTGACTGTTCTTC
TAAGACTAGTAAAATGAGGTCTGTACTGGTGGTGCTGGGGGTGGAAGGCGCTAGAAGACT
CAATTCTCCCATTCAGCCAACTGCACGTGGCCTTAAAAGTGACAATTTTGTAGGAGGGGG
GACTGTAGGTGCTGTGACACAAGCTTCTTAATTCTTGTAGATGAAAAAGAAAAGATTTAT
TTAAGGGCTGGAGAGATAGCCCAGCAGTTAAGGCAGAGCCTTTCAGTTCTGGCAGAAGAC
TCTACATTAAGGTCCCAGCACCTACACAGTGGCTTGCAACTACCTTTAACTCTATCTCCA
AGGGATCCTCCAATGCCTTTGGACTCTATAGGCATTTGTGCTCATATACACATAACTACC
CACCAACACATACACATCATTTAAAAATAAATATTTTAAAATGATTTATTTCTACATATA
CATAAAAATAATATAAAACTTTAACGACGAATTGGTCATGTATGTATATGCACATACATA
CATGTTAAACATGTATGGGCTGCTGTGAGCTGCCTGACATGGATGCTGGGAACCCTGACT
GGGCTTTCGGCAAGGGCAGCTCTAAATCATTGAGCCATCTCTCCAGCCC
  Untranslated Region
  Coding Sequence
  snoRNA
AC_000078
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved