Pongo_pygmaeus Locus IF5_PONPY
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus IF5_PONPY
Pongo_pygmaeus
IF5_PONPY
14
SNORA28
4703..4828
11035
CTCATTATAAACGCCTGCTCTGGGCTACGATTTGCCTGTCAAGAAATTCACAAGTCATA
AACTGGAGGGGTGGACTCGACGTGATGCCCACTAGGAGCAAGGTGACAAGAGAAGCACGA
AGGACAGCGCTTTTCAACCCTGGGAGCACAGGGAGGCCTTCACCAGAAGGTGGGAACCCA
CCACGAAGCGCCTTCAGGAGGCCCCGGGATTCCAAACCAACTAAGGGCCTCCTCTTCGGA
AAACTGGAGGCGACGCGCTGAGCTAAGCGCGCAGGCTCGGTTGCGGGCCGGCACCGAGGC
GGCGCGGCCTCGCGACCGCCCTGGGCGGTCACTGGCGAGTCACGGGCTCGTTCCGCCAGC
GGCCAATCCACTCCGAGTCCGAAACAGAAGATGGCCCTGGGATGAAAGACCCAGGCCTGG
GGCTTAAGGTGGAAAAACAACTCATTCCTCGAGGCCCGGAGACGGGCGTCCCGGGAGGAC
GGGAAAGGCAGACGAGCGCCCGCTGCGGGGAGAACGCGGTCGGGTTCCTCTCCCCGAAGG
TAGCGGCCGCAAAAACACGGCCTCGAAAGCAGTTTCGAGGACGATGTCTCCTGCGTCCCG
GGAGTCGCCGCGACGCCGCGGCCTGGCCCAAACCCGGGAAGGGAGGGGACCAACCGCCAT
CTTGCCCGCAAAGCCCAAACCGACAAAGCACTGCCCCCGGTGCCGTAGCCCCACCACCAG
GGCCACTCCGGGTCTCGCGAGACCCAAGGGCTGCGCCGCGAAGACCTCTGGGAAAGGCGG
GGGGAGGGGAGAGGAAGGAAGCAGGGCCGGGGCTGGAGGCGGGCCGAGGCCGCGAGTGGA
GCCTCAGGAAGCAGAAGGGGCGCGGAAAGACGCGATTGACGTCGCAAGCGAACCAATGAC
GAGAGAGCTGTGGCAGGCCTCCAGCCAATGGGCAGTGAGGCCTGACGCGGGGGGCGGACG
CTGGGGCCGAGGGTAGCTTGAGCGCGGCGGCGGCGTTGTTCAGTCAGAGCGAGAACATTC
CAGAGGTGAGTCGGGTGGAGGGGCGGCGGCCCCGCGCCCCCTGCCCGGTGCTTCCCGCCC
CCTCGACCCCGCGGGCCGCTGGCTGGCGGGGAAGGCGCACCCCCCGACCGCCCGCGGCTC
ACGGCGCAGTCTCTCCGCGCCAGGTCGCCAAGCTCCGGCGCTGACGGGTGTGGACCGCGG
ACGTCCCTGGGACAGCCCCTCCCCGCTGCTCGGCGGCGGTACCTGGCCCGGCCGCTCCTC
GCTGCGCTTCGCCTCCGCCTCCTCGGACTCGGACTCGGGTTTACATCGCGCCTCACTTCA
TCCCAGTCCCGGGCGAGCAGCGTTGGGTTTATGTCTTTATTTGACGAAATCGGTGAGTCG
CGGGCGCGGCGGCCCATGAGATGGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAAAAAAAAAATTATAACCATTCACAG
TTAAATAATTTTTCTCCTTTGTGAATCCCTAAAAAATAAAATCCAGAAACCGTTCTCGCA
CCCTGTCCATCCCTGCGGGAACGCCAAGATAAAGGACCCCTCTCGGGCTGACTCAGGCTT
CAGCTGCTGCATTTGTGAGTCATCGCGCGCTCCGGGGCGGGGGCGGCCCGATCCCGGCAC
CCCTCGGTAGTGTATCGCTTCCCGGCTGTGCACCCTCCGGGGCCGCCGGCTCTCGGAGGA
CGCGCTGGGGATGGGGCCAGACGCCCCGGTCGCGCGCCGCTCTCCTTCGCGGAGCTGTCC
GGCTCGCCAGCCCCCGCGGAAACGCCTCGGAGCGCGGTAGCCATGGGGACCAGGGCGAAG
GTTAACCGAGTGTTTGAATAGCGAGGAAAAGGGAGGCCGGGCCGAGCCTGGCGTTCGCTC
GCGCTCTCTTGCTTAATGGCACTTCTGGGCGAGCGCTGCGTTTAAGGAAGTGCTGCTTTG
AAGTAAGCCGTGGTTGCCGAAGCAACAATTAGTTGTAGAGAGCAGTTGTCTAGTTTCCCC
TTAAAAATGATAACGAACGGGGGTGTGCCTGAGAAGTTTGCTTATCCAGGCGGGATGGGC
GGCGGAGAGGGCTCGGCTTCGTTCTTCAGCACTTCCAGGATGGCCGCAGAGGCAAACCTG
CTGATTGCCCTCGGTCGGATGGAAACTCACGGCGGCTGAGGCAGCACAGCTTGTGTTTTC
TTGTCAGGCATTTCCCTACCGGAGTCACACCTTAGTCGAAATGGAGGCCTTTTTATGTTC
CCGCAGATTGTACTGTTACATGAGAATAGCTGTTTGCATGTGATCTCAGATGCTTTTTAA
GGTAGAATTAAGCAGAAGCATAACTAGGGTGTAAAAGGAGGCGTTTCCATCCAGCGATGG
TGTTAAACCTGGGGGGATTTTTGTGTGTTCTTTCCCTTTCTCTTTCAGAGCTGTTGCGCA
GCCATTGGTACCTGTATTGGGGAAACATAGCATACAAGCAAGAAGCTTACAGCCTCAGTG
GCGAAAATTTTTTCATGTCAGAGACCGAGAACTCTTGCAGTCGTTTATGTCATCCCTTCT
TCTCCAGACAGAAGATACCAAAAAGTTGCAATCAAAGATCTCTTCATCTTATTGATAAAG
CCACTAATAAGCCAAAATGTCTGTCAATGTCAACCGCAGCGTGTCAGACCAGTTCTATCG
CTACAAGATGCCCCGTCTGATTGCCAAGGTAATAAATTGCTCTTCAATTTAGTTGATCGC
TCTTTTTGTAGAATTTTGAAGTTTGCATTTGTCGGGGGAAACTGCACAACTAAAATTCTT
ATTTCCTTTAGGTTGAGGGCAAAGGAAATGGAATCAAGACAGTCATAGTCAACATGGTTG
ACGTTGCAAAGGCGCTTAATCGGCCTCCAACGTGTAAGTAAAGCTTGGAAAAGTCCATAA
AGGGCATATTATGGATAGAGTCTTCAAAGTCTTTGAGCTGCAAAACTTGTTCTAATTGTA
TGCTAGCTAATTAGCTTACAAGTTAAGTGAGGAATCGTGGTTTATTGGTTGCCATGAGTT
TACAAAACTACCAGGGGAACACATTTAATTAAAGAGTGGATGGCCGGGCGCGATAGCTCT
CACCTGTAACCCCCAGCACTTTGGAAGGCTGAGGTGGGCAGATCACGAGGTCAGGAGTTC
TAGACCAGCCTAGCCAACATAGTGAAACCCTGAATCTACTAATAATACAAAAATTAGCCA
GGCGTCGTGGCATGCGCCTCTAGTCCCAGCTACTTGGGAGGCTGAGGCGGGAGAATCGCT
TGAACCCCGGAAACGGAGGTTGCAGTGAGCTGAGACCACGCTGTTGCACTCCAGCCTGGG
TGACAGAGTGAGACTGTGTCTCAAAAAAAAAAAAAAAAGTGGTCATACAAATGTGAGTGA
GTAGCCAAAGATCTAGTTAACTGTAATGATCCAAACTCCTCTTTCATTCAAATAGATCCC
ACCAAATATTTTGGTTGTGAGCTGGGAGCACAGACCCAGTTTGATGTTAAGAATGACCGT
TACATTGTCAATGGATCTCATGAGGCGAATAAGCTGCAAGACATGTTGGATGGATTCATT
AAAAAATTTGTTCTCTGTCCTGAATGTGAGAATCCTGAAACAGATTTGGTAAGTGCTTTT
GTGGTTGTCAAAAGAAAAAGCCGTATACTTATTTTGTGATACCACTAAGTCACCTTTCTG
AGAAGGCAGAGCAAATGTAATTTTAAATCAAACACAAAACTCTAGTTTTGGAGATATTTC
CATTCTTTTTTTTAAAGTAGGTCACTGTGTGAAAAAAGTTTTCTTTGCATGTGAAGCTGT
CTGTGGTTTAGATGTCTTCTGATTAGATATTTTCATGTTATATTATGGATAACGTTTGTT
ATTTTTTTGGCAGCATGTCAATCCAAAGAAGCAAACAATAGGTAATTCTTGTAAAGCCTG
TGGCTATCGAGGCATGCTTGACACACATCATAAACTCTGCACATTCATTCTCAAAAACCC
ACCTGGTGAGTCTTCCATGATGAACTCCTAAGATCCTAAGATAAGTGACTAACTGTTGGG
AACAAAATAGAAGATTTTTTTGTAATAGGAATGTAAGGGAGACTGGGCACGGTGGCTCAT
GCATTCCCCGCATTTTGGGAGGCCAGGGCGGCCACATCACTTGAGGCCAGGAGTTCAAGA
CCAGCCAGGCCAACATAGTGAAACCCGTCTAGTAAAAACACAAAAATTAGCTTAGCGTAG
TGGTGTGCTCCTGTAATCCCAGCTGCTTGGGTGGCTGAGGCATGAGCGTCGCTTGAACGT
CCGAGGCAGAGGTTGCACTGAGCTGAGATCGTGCCACTTGCACTCCAGCTTGGGCAACAG
CGACTCTCTCAAAAAAACAATATAAGGAACTTTTTAGTCCTTGTACTATGTTTTATCAAA
TCCAAGACATCTTTCAAAAGTGTATTGTTAATTACCATTAAAAGTGAAAAATAGGCTGCC
AATTAAACTGTGCCATATCAATTAAGACAGATTATCTGAGGGTAGATGAAGTAATGACTA
AAATTCTGCTGGAAACCCAGCAAAGGATCTTTTACTGGCATTGTTTGGTAAAGAGGGTCC
GCTTCATTAAACTTGAGTATTGCAAGCAACACTCTGTGGCAGATGATCAAAACTGTCTGA
CACAATTTGAGCTTGCTATATCAAGAAAGTCTAACCTATTCCGGTGTTCTCTCTCCCATG
AGATAAGCCGTTATATAGACTTAAACAGTGTTCTACCTGTTGGCTAAAGCTGGGTTGAGT
TAATGACTTTGTTCATGAGGGATGACAGAGAGGGATCCTTAGGGCCACCTCTCACTCACT
CCCTAGTGGAGGCATCATCATCTTAATCTTACCTAGCAGTTACAATACCCCTAATATTTT
GTGTAACTCCATTCTTAGACTGACATTCTTATGTATGAAGTACATGATGAATTTCATCTG
TGAAGCCTCTTAGGTAGCATTGTGTGTGCTGTGTGGTTTTTCTGAGGGGATCCATAGGAA
AATAAGGGCAGGGTTTTAAATGTTAATGATGGGCAATGAGGTAATGTAAGTTATGGGGTT
AAATTTTTATTTCTTTTTTTTTCTGTAGAGAATAGTGACAGTGGTACAGGAAAGAAAGAA
AAAGAAAAGAAAAATAGAAAGGGCAAAGACAAGGAAAATGGCTCCGTATCCAGCAGTGAG
ACACCACCACCACCACCACCACCAAATGAAATTAGTCCTCCTCCACATACAATGGTGAGT
GCAGGGTTGATGGCCTAGTGGGCACTAAAGATGTGTAAAGTATATGGCATTTGGTTGAGG
TGGGTGGAAATGTTGAAACTAGCCTTCAGTGTGTAATACACTAATATTTTGGATTCCAAG
TACTGTTGGTTGTTTGAATTAAGGTGAACACAGTTTTGGTGGGAGATGGACTTGATGCCA
TTAACTTGGAAAAATCTGAAACTTTTTTTGTTGTTTTTAAGGTCTTTGATCAAGTAGCTC
TGTTTTCGTAAACAGGAAGAAGAGGAGGATGATGACTGGGGAGAAGATACAACTGAGGAA
GCTCAAAGGCGTCGAATGGATGAAATCAGTGACCATGCAAAAGTTCTGACACTCAGTGAT
GATTTGGAAAGAACAATTGAGGAGCGGGTCAATATCCTGTTTGATTTTGTTAAGGTAAAA
CGTTTGCTTGGTCTGTAAATCAGCTTCAACCCAGCCTTGTTTGTGCCTTTAGATACATGA
TACTTTAGCAGTGTAATTAGGATTACTCTAATGCACGACTTTTTAGAACTCTTGTTCATT
TAAATATTTTTTTGCGCGTGATTCCAGGCACAATGTGTCACAACTGCCAAATTAGGTAGG
AAAAATATGTCCATCAGAGCAGGGACTGGCGGGTATCTTGAGCCTGGCAAAGTGTGCCTC
CATTGCACTGAATTGTTTTCCTTTTATTTGCAGAAAAAGAAAGAAGAGGGTGTTATTGAT
TCATCTGACAAAGAAATTGTTGCTGAAGCAGAAAGACTGGATGTAAAAGCCATGGGCCCT
CTTGTTCTGACTGAAGTTCTTTTTAATGAGAAGATCAGAGAACAGATTAAGAAATACAGG
CGCCATTTCTTACGAGTAAGCAAATTGCTCTGGATTCATAAATGAGATTACAGCTGTGTG
GCTTTCGAGATGGTCATTTTAACCACTTTTGCTCGTCCTGTCATGCTTGAAAGTGGGGGA
ATTGACCCACCTTATAAGCCTCTGAGTATCTGAAAGTGCCTTACCTAGGCCCTTACAGAG
TAATAGGGATATTTATGCATTGACCTTTTAGAACCACTATGGTATGGACCGTGCACTTGC
AGACACTCTTACTTGGGTAATGGAGTTGTCAACTTAAAACATATAAAAAAAGCTTGTTAA
CACCAAGGTGTCTATTTGCAGTTTTGTCACAACAACAAAAAAGCTCAACGGTACCTTCTT
CATGGTTTGGAGTGTGTGGTAGCAATGCATCAAGCTCAGCTTATCTCCAAGATTCCACAT
ATCTTGAAGGAGATGTACGATGCAGACCTTTTAGAAGAAGAAGTCATCATCAGCTGGTCG
GAAAAGGTGGGGAATACATAGGTGGGCTCTTCAAGTTCACAAGTTTTGGGGGTTTTTTTT
GGTTGGTTGGTTGTTTTTGGAGACGGAGTCTCACTCTTGTTGCCCAGGCAGGAGTACAGT
GGTATGATCTCGGCTCCGTGAAACCTCCGCCTCCTGGCTTCAGGTGATTCTTCTGCCTCA
GCCTCCCGAGTAGCTGGGATTACAGGCACCTGCGGTCATGCCCAGCTAATTTTTGTATTT
TTAGTAGATGGGGTTTTACCATGTTGGCCAGGTTGGTCTCGAACTCCTGACCTCAGGTGA
TCCACTGGTCTCCCAAAGTGCTGAGGTTACAGGTGTGAGCCACTGCGCCCAGCTGTTCAC
AAGTATTGAGACAGGGTTTTGAGATGAAGAAGAAATATCTAATACCTATAGCTAAAGTTC
AGTCCCTGTGCTGTAGATTGTGATTCACACCATGTCAGCTTTGTAGTCATAACAGACTGC
TGAGACTAATGTGTTCACCGAGTACATTGATTCTGTTTGAGGTTTCAGACTTGTTAGGAG
CCAGTCCCCTCAGCTCAGTAAGGGGGATTGTATAAATAACCAAAAGTTGTTAAAAGTCCT
CAACTGAGAGACTTGTACTCACATTTTTTAGGCCTCTAAGAAATATGTCTCCAAAGAACT
TGCCAAAGAGATTCGTGTCAAAGCAGAACCATTTATAAAATGGTTGAAGGAGGCAGAGGA
AGAATCTTCTGGTGGTGAAGAAGACGACGAAGATGAGAACATTGAGGTAAACATTGGGGG
AGGAGAGGGTATTGGATACAGTGCTGGCGATGGGTGTTTGATATTTAAAAAGGTTTGTGA
GGAGTGATAAAATGGCAGTTTGAGGTAATTTCAAGTTGAATTTAAGATGCAATAAAATAC
AGCCTCTCAATAATTTGGAAAATAATAGGGTGATGGAAACTGTTCCTAGTCCTACACAAT
TATAGTCTATAAAAAACTTTAAAAATGCTCTTAGACTGGAGCCTTGTGTAAGAGAACTTG
CAGTGTTTGCGTAACAAAACTGTTCCGTGAAGAAGAAATAGCTGCATTAGGCAGTTTTCT
TCCTCTGTGACCACAGTTTACATTGATATGTTTTATAAACAGATTTATTAACTTACGTTG
AATAAAACCATTCCTCTTATCAGGTGGTGTATTCGAAGACTGCCAGTGTACCGAAAGTTG
AAACTGTAAAGTCAGACAACAAGGATGACGACATCGATATTGATGCCATTTAAAGGGATG
GATGCAACCTAGCTTAACAGTATAATGCTGCAAATTTTTCTCCATTATCAGCCAGAAGTG
CAACATGTATGTGCAAAAGCTAAAATGGCTTAACATCATGCTACACTTTACACTAAAAAT
CTATTACTGTGAGTGGTCTGTAATTAAGCCCAATGAGACATCTAGGGAGTCCATACACAT
CAGTGAGCAGATGTAGTTTGCTTATTTATAGCATGTTTCTTTTTGAAAAACTAGTGGTGG
ACACATTTGGATCACATTTATACAGTTATAAAAATAAAGATTTGATTTTGGTCGTTCTTC
AGATGTTTGGCTCTGAATGACTTAAGCTGAAGTAACTGGCTCCTTATTTTAAATGTTGTG
CCATCATTTCACCTGATGAGCATTCTTGGAGCCTGCCAGATATTGTTAGGTCCTGGGGCT
GTAAAGAGGTCTTCAACAGGATGTAAAGGAAATTTAATTGTAATTAATTTATTCAGCCTA
TTAAGAAATAAAGTACTAAAGTTTTATCTCTATAGTTCCTCAAATTGGCATCTGGTAATG
TACATTGTGAGGTAGACTTTGATAAGCAAATGACAATGCAACATCTTACCAAGAAGTAAA
TATGACCTGAGTGTCCTATAAATAATGTAAGAGCAGGAGTTGAAACTTGGAGAGCTGTTT
TCTCATTTCATGTACACTTGCCCCAAATTGTCTTTGAAGTCGTGTGCATTGCACGTTGGA
TGAGTCAGGGAAATTATTACATTAACAAGCATTTTGTGTGTACGTAGTAGTTACTTTGTA
CTGAGAGAACTTGCTTTGGGGTGCAATTAAACAATAAACTGATTTTATTTGGGAGAAACA
GGGAAGGGTGCACTTAACTAGCAGCCTAAGCATGATTTTTCAGCTTTTGCCCTTAGGGTT
TAAATTACAATTCCAAAATGTTAGACATGCTGTATCTTTTTGTTCAGTGTGGCTTTAATC
GTCCCCTCTTATGGTTTGTTCTGTAATGCCTTTTACATTTGGACACATAGTTTATGCTTT
TTAGATTTTGGTTGCTTTCTTGCCAAAATAAGTGTTAACTGTGTTTCAAACTTGATTTTC
TTTTTTCTTTTTTTTTTTTTCTTCCAGAATGTCTTATTTACAAAGAAAGCTAAAAGTATA
CTTCTAAGTCAGAGCCTCTATTTTGGTGTAAGACTTGGGATATTTTTTACTTCACATTGA
ATATAGCCAGGCACCCAAGAAGTCTGATGGCCACCTGAGTGCAGGTGACAAGGACCTGAC
AGAGCCCATGCAGGGCTTTAGATTTGGACACACAAGAGTCGATAACTTCCTCGTGAACTC
CTTGCCTGATCTAAACTCATATTATGGGTTCTGACTGTGTTTGAGTAATCATCTTCAAGG
TTAAACCTGTTGGCAGTTACCCCTTTTCACAAAGTGCACAGTGGGAATCGAGAATCAATA
GGGTTAATTTTGGAGCAGTAGCTTATACCATTCACCTGTTTTTTTGTGACTGACTTCACA
GATAATGAGACCTTAATAACAAATAGGCATAAAAAATTTTCACATTGAAATGATACAAAC
ATGATGTAATAAAACCTTGTTGGCTTGATATTTTAAGGAATTGAAACCTAGCAATTTTAC
TGGAGAGACAAGAATTGGTCTCCAGCTGCCTTTGATAGATTCGGGTGCAAGTGGAGCAGG
AGCCATATACCTGGAGGGGGAATGTGCTTTGTCACACCAAAGAGGATTTTTTTTTCTTCA
AACTTGTATGTTGCCTAGGTTTCAAATTCTTTGCCACAAGGCTGATTTGCTTTCATTAAC
TGGAATTCTGTAGGAGATACTGGTGACCTAAGCTAAGTTGCACTCAACATACTCAGTGTC
AAGCTAATGAGGTTCTGTTATAAAGCTTCTACTTTTAATCTGAGGGAAAACATGTTCAGG
GCTTCTAGAACACTAAAAAATTTGGCTTAAACCAGTGTTCAGTCTGGTGCCAAACTTCCA
ATAGAATACAAATTCACATAATCTGAACTTTGTTCACAGGTTATCCTAATAGAGTAATTC
TTCACTTTGCTCTATTGAACTGTCTTAAGGATTTGTTTAAACAGCTAAGTTACTTGATTA
AAATGATAAAATTGTATTTTGTCTCTGCTTTAATATTAAAATTAACTTGTTTTCGTTTTA
TAATGAGATCAAAGCATTGGAATCTGCCCTGTTTTGTAGCTGTTGCTTTGGGTTTGTGTT
GGATGTATCCTGCAGTTACACTTGCCAGCCCCACTCACAAAAGTTGTTCATTTCATTGGG
TCACTGGCTTTATTTGCTAGTCTTGTGGTCTGTGAACTGAGAATCTGCCTCAATTTTATT
TCTTGAAATCTTGGCAGGTACTTAATAGAGAACTCAGACTTCAAATATACAGCTATGTAA
CTGAATAATTGTATATATCTCTAGTTAAGAATGAGGGAATGGGGAGGTTTGCTTTCTAAA
CAAGTATATTCTGAAGTTGACTTAAATTTTTAGTGTGGGTCCTAAAGTTTAGAGATTGGC
AAGAAGGTCTCTAATCCACTGCTTCCCACTTGAGAAGGGAGGGGTATCAAAATTGAGCCT
CAAGCTGTTTGTTCCAGTGTACCAAGCACTGACTTTATGCCTTTGGCCTGGAGATGGCAG
AAGTGAAAGCTGGCCATCTGCAAAAAGCAGATAAGTGAATTTGAACCTTTTGCATTTTGT
TAGTCAGTTCTCATCATGGTCCTGAGGCATAGGTACTGTTGTACCAAGGTCACTTATCTA
ACAAAATAACCAACCCTTCATGTATTTTAAATTTCTCTGACAAGTCTGTAGACAATCCTT
ATCTAACCAACTATTTTCTTAATTGCTGTAGCTTGACCTACCAGTATTCTGGAGTAACCA
GCAAATGCAAAGTTGACCTCGTTCCTGCATCGTCTTTTTGATGGTTCAAATTTCAGCCTC
CCTGACTACTCCAAAGCCAGAGCAGTCTTAGTACCAGAAACAGTGCTGCACTTTTGTCTA
CTTCCTAGCATGTGCTGTGTGACCCCATAATGACATTCCATAAGTGGGGTGACAGCAGAT
GACTTGCCAGTAGTCTCATTGTAGGTTTGTGCACCAGAGTGACCCTGTGAGCCTTT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1024, 1163..1371, 2508..2787, 2891..2972, 3535..3707, 3973..4084, 5188..5333, 5595..5753, 6033..6194, 6501..6665, 7291..7425, 7823..10035
2716..2787, 2891..2972, 3535..3707, 3973..4084, 5188..5333, 5595..5753, 6033..6194, 6501..6665, 7291..7425, 7823..7909
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved