Pongo_pygmaeus Locus C17orf45
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus C17orf45
Pongo_pygmaeus
C17orf45
17
SNORD49, SNORD49, SNORD65
1365..1436, 1894..1964, 3082..3154
4868
AAAAACACAAAAACGAACAATAACAACAACAACAACAAAAACCCTACACTTATTTCTGA
GGCCAGCTCAAAAGGTTTTATGATTGTCTTCCCAGTTTTTTGCAGTCAAAATTAATTTCT
TTGTCTTGGTATAACGTGTGTGTGCAAAACGTGGTTGCATGGATTATTTTTCAAAGAGAG
AGCTGAGCATGTTCATAGGCTGAAAGGAAAGCCACAGTAGAGAGTTTTCCGTGGAAGGTG
AGGCAGGGGCATAGGTGGAGGAGGCCCCAAGGAATGAGGAGAGGAAAGGAGGTGGGCAGA
GCTTTACCCCAGAGGCGAGCAGAGGATGGACGTGGATCCAGATAAGACGTCAGCTCGTTC
CCTAAAGGTCGTGCTAAAGGAGTAATGAGGTGACCAGTGCGCAGGGGTTTGAGAAGCCCC
GTGGATGTGGTGAACTAGCTGTGGGGAGAGTATTTGGCGACGCTCAATAGATTCAGGAGG
AGCTACTAGGATGAATGGTTGCCGTGTGCCACGGCTCTACAGGGTTTCACGTATGTCATC
TCACGTGATCTTCTGGGGCGCGGGTGTCTCCGTTTTCTAGATGACCAATCGGAAGCTCAA
AGAGAATGAATAATTGGCCCAAGACCACCCAGCTAAGGAGTGGCGGAGGTGGGGCCCAAA
TGCGCGCTCCAGCCCTCGCGCAGGCGCCCTGGAACTCGCCGCGCGTGTTGTGACCCAGAA
TTCCCGGGGCTGTGGAAGAGACCATAGACTCAACAGGAGGGGGAGTCCTGGGTAGCGCAC
CGATCTACATCGTTACTTGGCGGAAAGTTCCCATGAGTCTTTGCCAGCGTCCCCCTCGTT
TTGTGAGGAATGGGATATTCCGACTCCTTAAGGGCCTGGAGCACATAAGGTGTGACCTTT
TCATTCCCGTTGTCATGGAGGTAGGCTCTCTAGGAATCTGGGAGTAGTAGCTGAGGGGCA
AGAGCAAATAAAGAGCTCGAGCTTCTGTGGTCTCTGGGGAGATGTTCCCGGGAAGCCTGG
CTAGAGGGCGGAGGGCAGCTGTTGAGATGGCGTGGCTTCCCGGCTCCTGCGCCCGCGTGG
CTTTCGCGGCGGTCGCTGCGGCCCGGCATTGGACAGCCTGGCAGGGCAGCGCGGGGCCGA
ATCTGGCTGCCGTGGCAGAGGCTCATGGATCACTCCTTTGTGGTAGGGCCACATCTGCCA
GAGCCTGGAGTCTGCGAAGGCCGGGACCCGGTTCCCCGGCCCGCCGTGGGGAGTGTGCAA
ACCCGAGAGAACTGGGTAAGTTGGGGTCGGCTTGCAGTTTGGGTTACCCCGAGGGCGGTG
TACGTCGGTAAGATTGTAACAGTATTACTGGAAGACTTACTCGACTGTCCTGATGATACT
TGTAATAGGAAGTGCCGTCAGAAGCGATAACTGACGACGTCTAACGTCTATCTGACCGCA
GTCGCTGAAACCTCTACAACTTAGTTGACCGTAACTGCCAGAGCCCTGCCCTGAATTCCT
GTCCTTACTCTCTCTTTCAGATTGCGTACCCACTGCAGAGGGCTGAAGACGGGGTAGCCA
CGAGGTAAGAGGCTCTCTGGGGCAGGGTTTAACATGGAACGTAGTTTTGTCATCTTAAAT
GCACGGAAATTGGCGTTTTGACAGTTTTCTACGTTTAGGTGTTTATACACTTCAGGGTAA
CGTATCAAGTCATTGCATAGGGTGGAACTTAAATAGAAACTGGAGATGGCTGCTTCAGCC
ACAGTCCTAACCTAGAACTGCATTTAAAGCAAACTAATATGCAGAAACAAACTCCTTCGT
TAAGAAATGTCTCCAGTAGCAGGGTTAGCTTAAGTTTCAGGTAGGGTCTAGATCTGCGGT
TGGAGCAGTACTGGAGGGCTGTGAGGTGCTTGACTGCTCTGATGAAATCACTAATAGGAA
GTGCCGTCAGAAGCGATAACTGACGAAGACTACTCCTGTCTGATTGCAGTCAAGTCTTCA
CCACTTGCTGGTTCCCAGGAGTAAACTTGTGTGAACGATGACCTAATTGCTATATTCACC
TAGGTTGCAAATTCGTGAAGAATCAGCAGCATGTTTGGCAGCTGAGTATTGGAGCCAGGA
GCCTGCCATGAGGTAAGCCTTGCTCTATGGGGAGGCTAGTGGCTGACCACGCCTAGCTGT
TAGGTCGAATATTGGCAATTGGATTTGGTTAACCTAATACCTTGTTAACAGTGTAGCCTA
TCCCAGAGATACTGATTTTAGTTTCCGGTGGCAGTGGAGCCAGGGTGGATTACCTAGAAA
GAGGGGCTACTCTATTTACCTCTTGGCTGTTTAGTCTTGGGCAAATTACCTGTCTGCTGA
GATGTAGTTTTCCTCAGATGTGAAAAGGAAAAGTAATCTTAGCTTTGTGAAGTTTAAATT
GATGTGACTGAAATGGAGATTACAGCTCCCCTGAGGCTGGGCACAGTGGCCTGTAATCCC
AGCACTTTGGGAGGCTGAGGTGGGTGGATCACCTGAGGTTAGGAGTTCAAGACCAGCCTG
GCTGGCCAACATGGTGAAACCCCATCTCTACCAAAAATACAAAAATTAGCCGGGTGTGGT
GGCGTGTACTTGTAATCCCAGCTACTTTGGGGGCTGAGCCAGGAGAATCGCTTGAACTCG
GGACGCGGAGGTTGTAGTGAGTTGAGATCGTGCCACTGCACTCCAGCCTGGGCAACAGCG
AGACTCCATCTCAAAAAAAAGAAAAAATTACAACCTACTGAGAAGCTAATTAAGATTTGT
AGCCCTCAATAATTTACAAAAACTTAGAAAAATTACCTCTAATTAGGTCTTAAGGGGCTT
TTGTTAGGATGGACTTAAATTTGTAAAGTCATTAATTAACACTGTCATCAGAAATGCCTC
TCCTGGTCTGCATCTGCAGTCTCTAAGATGTATGTGCCTTCTCCATTCCCCAGGTTTTGA
GAACAGGGTGCTGTTTTAGAGCTGGCAGCAGCATCTCAGCCCAAGAGAAGGTAAGCCTTG
AGCTGGCCAATGATCCCCCAACCCCATAGTGGAATGAATAAACAGCTGATCTTGTTAAAA
CTTGCTTCAAAAATAAGATATCAAATGATGAAATCACCCAAAATAGCTGGAATTACCGGC
AGATTGTGTAGTGGTGAACCTACGGTTTTCTGAAGATATCTCTTACCCTGTGATTGACTG
TCAGTTGGTGCAGAAAGTGAGATTGAAATGTAGTTTCTTTGCAGGTTATATTCCCAGAGG
ATGTCAGTCCCAAGGACCAGTAGCTGCCATCAGTTTGGATTCTGAAAACTAACCGGCATC
AACATTGGGTGTAGAAACATGCTTGCCTTGTGTATCAGAGGACATGCTCAGCAGATCCAA
GAGATATATTTGGCAACTTTTTCTAGAAAAGGCACATTAGGTATCATTCATTACATTCTT
GAGTTTTTTTGGGGTTTTTTTTTTTTTTGAGACAGTCTTGCTGTGTTGCCCAGGCTGGAG
TGTGGTGGCACAATCACAGCTCATTGCAGCCTCAATCACCCAGGCCTAAGCAATCCTCCC
ACCTTGTAGCTGGGACTACAGCTCACAGCACACCTGGCTAAAATTTTTTTTTGTTGAGAC
GGATTCTCTATGTTGCTCAGGCTGGTCTCAAGCTCCTGGGCTTAGATGGTCCTCCTGCCT
CAGCTTCCAAAGGCACAGGCCAAGTTGTAGCTTTGTCCCTTGCCATCATGCCCAACAAGA
GGTTCTATACCTTTTAATGAACTGACTTTCATAAATTGGTTATGTTGGTGGGCAAGTTCT
TTAAGCTGGAAATTGTAAATTCCTCCTGAAATGTTTTTTCATGCAGTTACCATGAACTAA
TACTACAATAAAGGATGGTCTTGGGTGTCAATTCTTGAAAATGTGTATTTGAAGAAAAAG
TAAATTTCGCCTACTATTGTCAGATATTAGCAGTCCAGATATTTGCTCTAGCTTGTAAAC
TTCCCTGTGGTCAGCCTAAGCTCTTAATCCCCTATTCTACAGCTTTAGACTGAAGGCAAA
AATTCAAAGCATTTAAGGCCTCCTCAATTTCGGCCCCTGCTGCTCTGTGCTCTGATCCTT
GGTGTAGCTTTGTTCCAGCTCCTGCAGCATTGCACCATTCCTTAGAAGACACCATCTTGC
TGTCTTCCTGTGTTGGAATCTTGCTTGCCAAGGCCTGTCAAGCGGGTCCTCCCCCATACT
GTTTGCCCACAAGGTTCAAGAGTGATTGGCTCCCAGTCTCCCTGGACTGAACTACTTGGA
TCTAGGGGTTGCCTGTTATTTAGAAGAGATCCCTTAACTGGTAGGGCCCTTTCAGTAGGA
GAGCATTTGGGTAAAGGGAGGGTATAAGATGAGAACCTTTGCTAAGTTAGGCTCCTTTGG
GAGCCCCCAGTTTGTTTCTCCATCTCCCCAGCCATCTTGTTGGATCTGCCAAGGGATTGG
ACTCCTTCATGGTCCTAGGTTTTTAAGGTTTTAAAGCCCACCTTCTGAGGTCAGTTTTCT
GGAATGTATTGGTGGATTACTTAAGAATTATGGGGAAAGAGTTCTTATGGCCTGTCTCTG
TCAGTGAAGTCATACTGGCAAGTGACAAGAAGGAAGCCAGGTCTGTCACTTGGCCTGCAT
GCTAAGGACATCAGAGCCCACATAGAAGTCTGGTAGTTTTTCAGCCAGCGGTGGGTAGGG
AAGGTAGATAGGGGATTTCTGAACAGGACTTTATGCCTGTATGCATGGGCACCATGTCTG
TCCTGAGCACTGCCACATGGCATCATAGGCTGCTCTGTCAAAGGGCATAGTGATAGCTGC
TGGTCCTATGGGCAGATGCCTAGAATCAAGGTGGGCCTCAGAAATAGGGCTGGGTCTCCA
TAAGGAGGT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1250, 1252..1274, 1520..1563, 2043..2111, 2933..2989, 3224..3868
1001..1250, 1252..1274, 1520..1563, 2043..2111, 2933..2936
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved