Pongo_pygmaeus Locus IF4A1_PONPY
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus IF4A1_PONPY
Pongo_pygmaeus
IF4A1_PONPY
17
SNORA48, SNORA67
2881..3015, 6142..6278
7671
CCTGTGCAGGGAGCAGGAAATCAGTGCTGGGGGTGGTGGGCGGGCAATAGGATCACTGC
CTGCCAGATCTTCAAACTTTTTTTTATATATATATATATAAATGCCACGGTCCTGCTCTG
GTCAATAAAGGATCCTTTGTTGATACATAAGTCGTGGTCTTCCTTAAGTGGCCTCAAATT
AGTGGATATGCTTAGCTCAGACCTTCCAGCCAGGCTCGTGAGACTAAAGGGTTCAGCTTT
CCATCCCTGGCTCAGGCACTGCCAACACATTGTCTTCATCACCCAAACAAATCCCCCAGA
TTGGGGCAGAGGGCAGGAAGGAGGGCATCCGAGAGGGAAGCTGGGGAACTGGACACAAGG
GACTGGGGAGGGGACCAACCAGGATTCATGACAGTATCCCAAAGCCCTTTACAGTTTTCT
TCCATCCCTCCACCCTCCAGCCAGGGGAATCCTCCCATCCCTACGATATCGCTGTTGATT
CCTTCATCCCTGGCACACGTCCAGGCAGTGTCGAATCCATCCATCTCTGCTACAGGGGAA
AACATAACATTTGAGTCCAGTGGAGACCTGGAGCAGAAGTAAAGGGAAGTGATAACCCCC
AGAGTCCGGAAGCCTCTGGAGGCTGAGACCTACGCCCCCCTTGCGTGATAGGGCCTACGG
AGCCACATGACCAAGACACTGTCGCCTCGGCACGTGTGAGAGTGCAGGGCCCCAAGATGG
CTGCCAGGCCTCGAGGCCTGACTCCTCTATGTCACTTCCGTACCGGCGAGAAAGGCGGGC
CCTCCAGCCAATGAGGCTGCGGGGCGGGCCTTCACCTTGATAGGCACTCGAATTATCCAA
TGGTGGCTGCGAGCCAGAGCGACTAGGAACTAACGTCACGCCGAGTTGCTGAGCGCCGGC
AGGCGGGGCCGGGGCGGCCAAACCAATGCGATGGCCGGGGCGGAGTCGGGCGCTCTATAA
GTTGTCGATAGGCGGGCACTCCGCCCTAGTTTCTAAGGATCATGTCTGCGAGCCAGGATT
CCCGGTAAGAAAGGCATTTGCAAGAGATTGTGGCTGCTTATTTTGCCGCCCCCTTCCGAC
GGGCCCGCCGGGGGTAGCTGAGAGTCCCACCAGGGTTGCGGGAGAAACCGAGCCGGTGGG
GGGGGAGGGTCCGACCTGGAGGGGCGAGGGGGAAGATTCATGGCCGACGCGGCCACCAGG
TCGAGGCGGAGGGCAGGGAGAGCCCGGCTAGGGTCAGGCGTGCGAGGTTTGTTACGAGGC
CTCGACCCGAGGCGGTGCCGTGCGCGAAGCCCCGGCGCTGAGTGGCGAGACGGGGTCGCG
ACCTGGCGTGGAAAGAAAGGTGGAGGCGGCCGCCACTATGTGTGGCCGAGAGCCGGCAGG
TCCGGTTGCCTTACTGTGCCGGGGGAGGGACGGCGCGCGGGGTTCCGGAGGATTCTGACG
GTACCATTCGCGAGAGGCGGGGGTGCCTGGTCCTTAGATCCAGTCACTTCGTCGCGGCTA
AAACACGGGTCGGGGAGAAGAAACCGGCCGTTCAGTGTGCTGGTTTTCTTGACGGCCAGG
ACTGAGCCTAACCCCGAGGAGCGGCCGCGTGAGGCACCGGGAGCCCACCCGGCGCCGGGC
GGGCGGGTCCATTTTGCCGCACAAGCCGGGCTATTGGCAAACTGCGGATGGGCAGGTCCA
CCTTCCTTCGGGGGTGAGCGGCCTGAGGTATGGGAGGGCGACGCTACTTCGCGACGGGGG
CGGGCGGGATGTGGATTGTTCCATGGAGGGGTGGGAGACGCCGCCGGGTGGTCGAGGGAG
CGAGCACATGGTGGCCTGAGGCGTTCCCCTCCCCCAGCCTGCTTCGCTTTTAAGTGTTGT
GCAATCTCCCCCTTTGCTAGCTCGGCTTGGGCTCATTGTGCGCGAGGCCGCCACCGCCCG
CGGCCTCCCACATCCGGGCAACGCGAGGGGGGGGCTTCGGCTGGAGGGAGTGGGGGAGGG
CGCGGGCGGGATGACGTGGGGGGAAGGGGATGTCCTACCCTCCGATCTGGGAGGTGAAGG
GCGGGACTTCCGGCGCGCTGGTGCTGCGGTGGGAGGTGCACGCGCTTGGGCTTTAAGCGG
CTGGGTCGGGCCCACGTGGACCCGGCGGCAAGCACCACCTCTGGGCACCGTGAGCGCGGC
GGCATGCCTGCTACCCTGTCTTCAGAAAGGGTCACCCCCTTATGTCGGGGGTGGCCTGGC
CTGAGACGCTGCCTGCATGGGGCAAAGGCCTCAGTTTTATAGAAACTCCTCTGGGTACCT
CTTGGGAGCTGGTGGGAGTTAGATCTGGGAGAGCAGGTTGATGGCATCATGCAGGCCACT
CCTGACAGACCCCGGCTGTCAGGATTTCTGAGTGCTTCGGTCGGGCAGGGGACAAAACTT
GTGCTTTAAACCAACAGATCCAGAGACAATGGCCCCGATGGGATGGAGCCCGAAGGCGTT
ATCGAGGTGAGACTGGAGAAATGGAATTCTGTCTTCCCCCATTACAACTTTCAGCCTTAC
AGTTCTATAGAGTTAGAGTGGCCTCTTGATTGATTTCCCAGACCATCTAGAAGCAGCTGG
TTTCCCTAAAGGGAGGAGGGGTTGTGTAAGCTCTGAGGCTTTGGTTAGTACGCAGTAGAT
TCTGTTTGCTCTGAGACTACAGATCAGCTCCACCTTTTCCATGATTCAAGCTTTAATTTC
TTTGCATCCCTTAGAGTAACTGGAATGAGATTGTTGACAGCTTTGATGACATGAACCTCT
CGGAGTCCCTTCTCCGTGGCATCTACGCCTATGGTTTTGAGAAGCCCTCTGCCATCCAGC
AGCGAGCCATTCTACCTTGTATCAAGGGTGAGACCTCTCAGTCCCAGAAGACATTGTGGA
CTGTCCCTGACCTGGGTAGAGTGGCATCTGGTTGGTGATGCCCATCTCATATCAGCCAGG
GACAAAGCAACTCCTTGTTCATCCCAGCTTGGCTTTTGATCTGTGCCCATGCCTGGTTCA
TGCCTTGGACACATAGGTTTCCTTTAAAGAGGTGGTATTGTAGCCAGCTTATACTTGCAT
CTACAGCCATGTTTCTAGTCCAGCTTGGTGTGCAATACTAGATGAGTTAACAACTGGTCC
TTGTTTCTGATCTGGTTCCCATTGTGTAACTGTGTTGATTGGGAAGGTAATTTGTGAGCC
ATGAAATGCTTCGTTCATTGCTTGCTTATTGACCTCATTAACTAGGACTGGAATATCCCA
AAGGGTATGCTCTTTATCACGTTTAATTCCTAATTTATTTCTTTAGGTTATGATGTGATT
GCTCAAGCCCAATCTGGGACTGGGAAAACGGCCACATTTGCCATATCGATTCTGCAGCAG
ATTGAATTAGATCTAAAAGCCACCCAGGCCTTGGTCCTAGCACCCACTCGAGAATTGGCT
CAGCAGGTAAGAGTGGCTTCTATTCGCTCCTTAAGGGCTGATTTAGGGATGATGAGTATA
ATCCAAGGACCAGAGAAGTCTTCTCTGATAACCACCTTGGGAGGAAGAGATGGGTGCCCT
AACACTCTCAAGATCTGCTGGGTTAATTAGAAGCTATTTCTTACCCAAACATAACCATCG
CTTCCTCCACCCATTTCCTGAGTCAAATGGGAAGGCTATTGGGTGAAGCCTGGCTGGCTG
GGCAAGTTTGGCTGTGTTCTGAATAAGCACCTTCACTATGGGCTAAGAGACACCTTGGTT
GGTGGGGGTGATTTTACAGTAGTCAGAGCAGATGGACAGTCCTTTTTTCACCTTTGCTGA
ATGGCCAGAGCTGTTTCATGCCTGGGGCACACACAATTCTAATGCTGGACTTTTTCCTGG
GTCATGCTGCAACACTGATCTCAGAGCATGTTTTTAAATGTTCTGTGGTGGGGGCAGTGA
TTATTCTGGGTGTGGATAATGTAAGAAGTTACAGCAGAGCTCCATTCTAAGGCACTTGGC
TCTCAGTTTTCTCAGAGTGAACATGCCTCGTAGCTTGGGTCCTATGGCAGGAGTGCAATA
GGACATGGCTACGCATCACCTGTTCTATAAAACTGGTTGCTGGCTGGGCGTGGAGGCTCA
CTCCTATAATCCCAATACTTTGGGAGGCCAAGGCAGGCAGATCACTTGAGATCAGGAGTT
GGAGACCAGCCTGGCCAACATAGTGAAACCCCGCTTCTACTAAAAATACAAAATTTAGCC
GGGCATGGTGGTGTGTGCGTTTTATCCCAGCTACTTGGGAAGCTCAGGCAGGAGAATTTA
ACCCAGGAGGCGGAGGTTGCAGTGAGCTGAGATTGTGCCATTGCACTCCAGCCTGGGCAA
CAAGCAAAGCTCTGTCTCAAAAAACAACAAAAAAAACAAAACTGGTTGCTGCGTGATGAG
GCAGTTGGTCAAATTAGCTTTCAGAAAGTTAAGGGTTCTAAATATTAGAGTAAGAAACTG
AATTAATTATCTGAGCGGCCTTATTGTGAATCACTGTACACTCAGGAACCAGACTGAGTT
GAAATGCTGTCTTTGCCACCTATTGACAGCACGATCTTAAGTGGATTTTAGCCTCTGCCT
GTTTCTCAGCTGAATGTGAGTTTAATAATAGTGCATGCCCCAAAGTTGTTGGTTAGGAAT
CAATACATGAAAAACATTTAAGAATGGCGCCGGGCACAGTGGTAGCTGACATATGAGCAC
CTGCCTGCCTCTCTCTGCTCAGATACAGAAGGTGGTCATGGCACTAGGAGACTACATGGG
CGCCTCCTGTCATGCCTGTATCGGGGGCACCAACGTGCGTGCTGAGGTGCAGAAACTGCA
GATGGAAGCTCCCCACATCATCGTGGGTACCCCTGGCCGTGTGTTTGATATGCTTAACCG
GAGATACCTGTGTGAGTAATTCAGTTCTCCAATCCCCTGGGTCACTTTGCTCTTGTGCAC
GCTTTCCAGTCTTTCAGCGTAAGCCAAAGTCATTCCCAAGGATGCTGGTTTCCCTCTGGG
GAAGAGCTGCTCTGTGATGGAGCCCATGCGTGTCATCTGAGCCTCTGGCTTCCCTGCCAG
CGCAGCCCAGGCAGTGTCCTACTTCCCAGGGCTGTTGTCTGCCTGGCGGGAAGGTCCTGG
GCAAAGGATCAGTCTTTGTACTCTGAGAGCAGACTACTTGACCCCTGTCTGTTTTTTATC
AGCGAAGTTGGATATATCTCTTCCACATTTCCCTAATTATATGCTATATATTGGCTTTTT
TTTCTTCTCTAGCTCCCAAATACATCAAGATGTTTGTATTGGATGAAGCTGACGAAATGC
TAAGCCGTGGATTCAAGGACCAGATCTATGACATATTCCAAAAGCTCAACAGCAACACCC
AGGTGAGGGCAGTCTTGCTTGAATAGCTAATGATTCTTGAAAAATAGCAAGTGCCGGGGA
ACCAAATTCTGGATTCTTGTCTTGAGCCTTTTTATGCATCCGCTTCAGTTTTAGGTGTGG
CAAGGGAAGGGAGCAGGCTTTGGGAAGGAACCACCGCTCTTAAGCCTGGCCTTTTTTTCC
ACTAGGTAGTTTTGCTGTCAGCCACGATGCCTTCTGATGTGCTTGAGGTGACCAAGAAGT
TCATGAGGGACCCCATTCGGATTCTTGTCAAGAAGGAAGAGTTGACCCTGGAGGGTATCC
GCCAATTCTACATCAACGTGGAACGAGAGGTGGGGCCCAGTGCAGGAGGCGGGCCTGGTA
GTGAGTTGTTGGGTATAGCCCCTGACTGATTTTTGTCCCCCAACCTCCAGGAGTGGAAGC
TGGACACACTATGTGACTTGTATGAAACCCTGACCATCACCCAGGCAGTCATCTTCATCA
ACACCCGGAGGAAGGTGGACTGGCTCACCGAGAAGATGCATGCTCGAGATTTCACTGTAT
CTGCCATGGTGTGTTTGCCCGCTGCCAGCCTGTTGTGGGTCTGCCCGTCAGAAGTGTCCT
ACTTGAAGCCAGGGTTCCTGGAATCCATGTGCCTACCTGGTCTGCTGCATGTTTGTTTTC
TTTTTCTAGCATGGAGATATGGACCAAAAGGAACGAGACGTGATCATGAGGTCTGGGAGT
TTCGTTCTGGCTCTAGCAGAGTTTTGATTACCACTGACCTGCTGGTGAGTAGAGGGAACT
GACAGGAAAGGCAGAAGGGAGGATCCAAGGTGATTCCCTCTCCAAGGGGACATCAGTGCC
TCTCAGGAAAGTAGCAGCTTGGAATAGAATCTGGCATGCCTAAGGCCTTTGGGGAACTGG
GATGCTTATTTCCTCTGCCTTCCTTGGCTGCCCACATGGATGCCTAAGTGTCTTCCCTCC
GGGATAGTGTCCTCCGTGCACATGCTGAAGAGTTGTCTTTCTTGACGTAGGCCAGAGGCA
TTGATGTGCAGCAGGTTTCTTTAGTCATCAACTATGACCTTCCCACCAACAGGGAAAACT
ATATCCACAGGTAAGTGTAAATCTGGAATACTCCCCCACCCCTTCACGCCTGGCCCTCCC
TGGGCTTAAAGCTCCTGATATTCCTCATCCCCTTCCTTGTTCTCCAGAATCGGTCGAGGT
GGACGGTTTGGCCGTAAAGGTGTGGCTATTAACATGGTGACAGAAGAAGACAAGAGGACT
CTTCGAGACATTGAGACCTTCTACAACACCTCCATTGAGGAAATGCCCCTCAATGTTGCT
GACCTCATCTGAGGGGCTGTCCTGCCACCCAGCCCCAGCCAGGGCTCAATCTCTGGGGGC
TGAGGAGCAGCAGGAGGGGGGAGGGAAGGGAGCCAAGGGATGGACATCTTGTCATTTTTT
TTTCTTTGAATAAATGTCACTTTTTGAGGCAAAAGAAGGAACCGTGAACATTTTAGACAC
CCTTTTCTTTGGGGTAGGCTCTTGCCCCAGGCGCCGGCTCTTCTCCCAAGAAAAAAAAAA
ACAAAACACTAATCCATTTCCCTAACCTAGTAACCTCCAGATCCCAGAGGCTCTCCTCAC
CTCAGCTGAGCTCCTTTGAAAGTGATTCAAGGGACTGTGTCACTCAGCCTCATTTGCTGG
ACCAAATCTGGAGGGAGAACCCCTAAAACCCGAGTGAGGTTGCCCAGGGGGTTGTCCCCA
GGTGGGGGGAAGCAGGGGAGAGAAAATGGTAGCCATTTTTACATTGTTTTGTATAGTATT
TATTGATTCAGGAAACAAACACAAAATTCTGAATAAAATGACTTGGAAACTGCCTGTTTG
GGCTTCTCATTTCTTACCTCCCCTTCCCTCTCCCACCTGCTACTGGGTGCATCTCTGCTA
CCCCCCCGCCTTCGCCAGCAGATAGTTACCTTTGGGCTGTTGCTTGCTTGTCACCATCTG
AGTTCCCAGACCCTGGAAAGCCATGTTCTCAGCTCTGAGAACTATGATGCTGACTGGAGT
GCTGCCCCTCTGTAAAGGGCTGGGTGTGGATGGTCACCAGCCCCTCACGTGCCTCAGCCA
AGAGGAAGTAGTACAGGGGTCAGCCCAGAGATCCAGGGGAAAGGGGAGTGGATACACTGA
TTTCCCCACCACTGAGGGAGGGGCCTGTACCTCAGCTGTTCCCATAGCCACCCGCAACTG
CCAAGCAAGTTTTGCTGAATTTGACACATGGATCCCTATGGATCAACTGCCCTAGGACTC
CCTGTTTGCACCCATGTGACACTGTTGACTTTGCCCTGATGAAGCAGGGCCA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1023, 2417..2465, 2714..2846, 3286..3425, 4702..4870, 5232..5341, 5525..5668, 5750..5887, 6009..6050, 6056..6103, 6350..6429, 6527..6671
1001..1023, 2417..2465, 2714..2846, 3286..3425, 4702..4870, 5232..5341, 5525..5668, 5750..5887, 6009..6050, 6056..6103, 6350..6429, 6527..6668
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved