Pongo_pygmaeus Locus RPL37
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus RPL37
Pongo_pygmaeus
RPL37
5
SNORD72
3473..3552
5870
CATTTTATTTTTAGTTTTTTCGGGTTTTTTTTGAGACAGAGTCTCACTCAGTCATCCAA
GCTGGAGCGCAATGGCGCAATCTCGGCTCACTGCAACCTCCACCTTCCGGGTTCAGGCCT
CCCTCCACCTCCACCCCGAGTAGCTGCGTTGGCAGGCGCGCGCCATCACGCCTGGATAGT
TTTTTGTATTTTTTTTTGTAGCGACAGTGTCTCCCTATGTTGCCCAGGCTGGTCTCCAAC
GCCTGGGCTCAAGAGATCCGCCCGCCTCAGCCTCCCAAAGTGCTGGGATTACAGGAGTAA
GCCACGGCGCCAGGCCCTTGGAAACTATATTGAACAAGTTCCATGTGTGATTCCTTGGCA
CAATGAAATATAGGATCAGATAACTTGCCTCTGATTTACTACAGTAACAGCAACAACAAC
AAAACCACTGTCTGCCTTTCCCTTTACATTCTAAGCTCCAGCTCCATGCCTCCGTACTCC
TCGCGACCTCTCACAGGGAAAGTCAGCGAGGCGGCTGGAGAAGTTGCTTTCTCCTGAATA
GGGATTATTCCAGGCGCACACGGTCATTACACGCCGGGGACGCTCAGTCGGTGCGGGTAC
CCCCGAGCAGGGCCAGCCCCGCATTCCAGGTTCTCCATGTGCCTAGAAGACAGTAATCGA
CGGTATAGCAACAGATCTGACTGCTAACGTGCAAAACCGATCAGTAGTAGCAGTAGCACC
AGCAACAGCGGCACGAAAAACAAAACTGTAATCTAAACGACCCTCAGGGTCCAAGCGGGC
CCGACGAAGACTCGCCCATCCGGTCGCCAGAAAACGGAGTCCCGCCCGCCTTTCCGGCAC
TGAAACGCGATCGGCCCTGCCTCGTACGGCATCCTCCTCTTGACCCCACCGACATCACGA
CGACGGACGCTTGAGAACGCTGCACCGCGCCCCGCAGGAAGTACTTCCCTGGGCGGAAGC
TTCTGAGCGTGATATAGCGGAAGTGCCTTCTCTTCCGGTCTCTCTGGACTCGGCCGCAGA
AGCGAGATGGTGAGTTGTAGCCGTGGTCTGGGTGAATCGCGTTCCATCCTCGTCCTTTGT
ACCTCTCTGCTTGCTGTGCTTGGGGGGCTGGCAAGATTCCGGATAAGGGGAACTGGTGGG
CAGGAAAGAGGCATGCGGTGGCCCTCAAGAGCGAGAAGAATGACTGCTAACTGGTGCCTG
GGGGACCTAACCCGCCGTAATTGTGGAGCTAGAGCCGCATTGTGTCCTTTGCCTTGGTGC
AACCTTTGGAGACCGTTCACAGTTCTAGCCTTGGTTGGGAGCCGAGGGAAGGAGTTTGGG
AATGTTTGGCTCTGTGTAACAATGAAATAATTCATTGGTGATGCTGTCTGGCCGGAGTCT
AAAGATAAGGTATATTTCAGAACATTGCAACTCTTGCGGAGGGCTTTAGGTAGCGTGAAA
TGCGGGTGGTGGTCTCTGACTTGGCATTCGTGGAAAGAGGCTTCTCCCACAGTTTCGACC
TGTATGATTGCCTTTAAATTTTATCAGTAATTGGTTTCCCGGAGAACTCGAGTAAATCTA
GAAGTTGCCAGGTTTCAGATCTATTTATTCTTTTAATGTGCAGACGAAGGGAACGTCATC
GTTTGGAAAGCGTCGCAATAAGACGCACACGTTGTGCCGCCGCTGTGGCTCTAAGGCCTA
CCACCTTCAGAAGTCGACCTGTGGCAAATGTGGCTACCCTGCCAAGCGCAAGAGAAAGTG
TAAGTAACATTTTTCAGGCCAACTGTGTTAGCTTTTGTTTGTATTGCACTTAAGTGGGGG
CGTAGGTTTGAACTTTATTTGGTGCCTATCTTAAAACTTGTACATCTGTATGCCGATGAG
GTGGCATAAAACTCGTGTGTTAACAATACCTACAAGGTGTGTGGGGGAAAACCGTTTGAA
ATCTTTTCTGAACTTAATGTTTTAGATAACTGGAGTGCCAAGGCTAAAAGACGAAATACC
ACCGGAACTGGTCGAATGAGGCACCTAAAAATTGTATACCGCAGATTCAGGTACAGTTTG
TATGTTCGATCATAATTGGTCCTATGGGCTTGAATGAAACCCTCGTTTTTACTTATAAAA
AGATAACAGTAGCCTGATGGTTACTGGGAATGAGATGTTGGAAGCTTTTTATTTTTTGCT
GTTTCTGAGGCAGGGTTTCACTATGTTACCCAAGCTTGAGTGTAGTGGCACGATCACGGC
TCATTGCAGCCTCAATCTCCCCAGCCTCAGGTAATCTCACCTCAGCCGCCCGAGTACCCG
GGACTACACGTGTGCGCCGCCACATGCCCAGCTAATTTTTGTATTTATTGTAGAGAATGG
GATTTTGTCATGTTACCCAGGCTAATCTCGGAACTCCTGGGCTCAGGCCAGATGTTGAAA
GGTTTTATCTTCTGCCGCTGTAACCTTGACATCAGTTAGTTTGGATTTTATTAGTAGTTT
TTTCACTAAACAGTAGTATAAATTAAATATCAGGAGCATTGTTTGAACTAGGGTCCCAAA
CTGTTGATATTTATTAGGTTTATCTTTAATTGATGTCAAAATTTGTCAAGACAGTAGTGA
ATAAGGTCTGGAGTCAGGCTTGGTTCAACCTTTAGTATAGTGGCTGTGGGCAAGAGTGCT
GTGGAAAATTGCCCTGATTGCTGCTGTTGCCTTGGGCTCTTGTTATTCAAGAGTCTTGGC
CTTAGAGTTATTAAATGCAGAATCTCAGCTCCACCGTAGACTTAGCTCAGAGAACCTGCA
TATTAAAGAATAGTTTCTAAGAGATTAACCCATCTAAGATCTCAGCTAAGATTCAGAATG
ATGCAGACTTAACTTTAAAGCTGGTGCTCCTTCCGTTACTGTGTTCTATTTCAGCAATTC
TCAGCTGTTGATATTTTGGGCTGGATAATTATTTGTGGTGGGATTGTCCAGTGCAAAATT
GAATATTTTGCAGAATCCGTAGCCTCTACCCAGTCAGTCTCCAGAGTGTCCAGTTTTAAA
GATAACAAGGTAGTTCAGGGCTTTGTAGACACCCATAGGTGTGTTCATGTGCTGAAGCAA
CTTTCTTTGCATTTAGGGTCATAACGTTTTTGTGGGCTTAATGTTGAGTGGTCTGTTAGT
ACGATATAGGAGTTAAGAGCTTGAACTGAAGCCAGGCTTTTAAAAGTAAGATAGTTGACC
TTTATTAGAGTAGATACGCATGTTAAATAAGTTAAAATGCAAAGCTCTTGGTTTAGAAAA
TGTCTGCCATTAAACATGCTAATTGTTTTTTCCTTGCTTAGTGAAAGTAGTTGGGATCTA
TTCTCGGTATAGGGAACCATTTTCACAAATAATCTGTGATCTCTTGCCAAATACGAACAA
ACATACTGGCCCAATGACTAGTATAGCCAAATAAGTTTTTGAGCCTTTATTGCAATTGCG
GTTAACTATATCCGAAAATGGGTATCTTTAAGCAAAGTGAAGTAAAGAATTGCAGCTTAT
CAGTGATGTTGTAAAAATAAATGTCTGAACATATGAATGCAGTATTGATTTCAGCGTTTA
ACTGAGATAAGCACATTGAAATCTGTTTAACAAAAATTAAAATTGCATCAATGTTGCTGA
AGTAACTTGTTCTTGTTTTTGACATCGTGCAGGCATGGATTCCGTGAAGGAACAACACCT
AAACCCAAGAGGGCAGCTGTTGCAGCATCCAGTTCATCTTAAGAATGTCAACGATTAGTC
ATGCAATAAATGTTCTAGTTTTAAAAAATATGTATCTGGTGTTTGGTAAGGTATTTTTAA
TCAATTAGGCTTGTAGTATCAGTGAAATACTGTAGGTTTAGGGACTGGGCTAGCTTCATA
TCAGATTTACTTGTTAAGTGACTGTTTTGGAATGTTTACTTTTGGACTGGGGTTGTAACA
CGGTTAAAGGCAATGAGAAACAAGCAGAATTCCAGGAGTCCTTGAAGCAGAGGGCACTAG
AAGACAATATAGCAGATTAAAATAGCACAGCTCATGTGGCATAGATGGGTATTTAAGATG
TTTGAGTAAATTTGAAAGAGTATTATGTTTAAATTACCTCTAGCAGCATGTTTATCTGTT
ATACTGTCATGACTAGGGGGATGATTATTAGTCACATAGAGCTTGGGAGTACCACTGGAA
ACATGGGTAGGAGTTTAGGTAGCTTCTGTTTTTCAAAAGATGATCTTATCCTAGTATCTG
TAATGCTCACTTGGCACACCTGACTTGTGGGCTGTGTGTAAGGTGGCTAGCTAAGTGAAA
AAAGCCTGCTGGGTGTGAGTCAACTTAAGAATATGTAAATAGGTTTGAGAAAAAGTAGGG
CTGGGTGCAAGTAAAGATTGAGCAGGAAATAAAGGAAAATCAAGTATAAACCCTGAGATT
TGTAGACTAAAGGCAATGATGTGGGACTACCTGGTTGAATTTTTTTAGCCCTCAACTTGG
TAATTGGGTGTTTCTGTGTTAAAGCACTGAAACTTGCTGACATGCCTTCCTAGTTTTGGT
GGTTTATTGACAGGGTTGGGTGTTTTTGTTTTTTTTAATGAAGGGACAAACTCAACTGGA
CTGCTGAGTGAGAGGGCAGGGGCAGTTGAAGGGAACATGAATGCTGGAACAGCTACATAA
AATAGTGATGTAGCCAAGTCATGCTATTTAAATTATAATTCTCCACTGTGTTTAGAATAA
CATCTGAGGTTCTTAACCTGGCCTTGGAAGGGTATCACTTTTACTTGTAACCTGGAATGG
CTTTATAATATGCTAGCTAATTGCTACTCTCATCTTGTATTTTAACTCCTAATTTACCCT
TCAGGTCTCAGCTTCTGAACATTCACTTGTAAAGAAACCCTGCTGATTAAATCTCTCTTG
GGCTTCCTCCCGAAATGTGAGACTATACTTTAAAGATGTATGGTTAGAGTCCAATTGCCC
TTGCCTTTCTTGTTTACAGATAGTGCAATGGCGCAATCCCAGCTCACTGCAGCCTCTAAT
TCCTGGGCTCGAGTCAAGTGGTTCTCCTACCTCAGCCTTCTGAGTAACTGGGACTACCGA
TGCACACCACCACACCTGGCTAATTTTTGTGTTTTTTGTAGAGGTGGAGATTCACTCATC
TAATTCTTTTTGTATTCTTAGTAGAGACTGGGTTTCAACATGTTGGCCAGGCTGGTCTCG
AACTCGACCTCGTGATCCACCACCTCAGCCTCCCAAAGTGCTAGGATTACAGGCGTGAGC
CACCGCGCCCAGCTATCATCACCAAACTTTCAAGTGAAGATAGTCTATTGAAGATTGAAC
AGTGACCTTGAAAGACAGCTGAGTTCCTGTGGGTATAATGTAAAGCTGGTGAAGTTTGGC
CAGTTTGGGCTTCAGAAGTCTAAGTCTAGTGAAAGTACCCTGACCCCCATATAAACAACC
CTTGAGGCCGGTGCGGTGGCTCACGGCTGTAATCCTGGCACTTTTGGGAGGCCGAGGTGG
GCGGATCACAAGGTCAAGAGATCGAGATCACCCTGGCCCACATGGTGAGACCCCAACTCT
ACTAAAAATAACAAAAACTAGCTGGGCATGGTGGCATGTGCCTGTATTCTCAGCTACTTG
AGAGGCTGAGGCAGGAGAATCACTTGAACCTGGGAGGCAGAGGTTGCATTGAGCTGAGAT
CATGCCACTGTGCTCCAGCCTGGTGACAAAGTGAGACTCCACCTCAAAAAAAAAACCCTT
GAACTAATGACTCAAATTTTCAAATTAAACAAAATAAGCAGTGGATCTTGCATTGGAGAT
GGAGTTAAACTATGTTGTCCAGGCTGGTCTTGGACTCCTGGTTTCAAGTGATCCTCTCAT
CTTGGCCCCCCAAAGTGCTGGGATTACAGGGACGAGCCGCCACACCCCACC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1028, 1603..1631, 1636..1738, 1945..2029, 3632..4870
1001..1028, 1603..1631, 1636..1738, 1945..2029, 3632..3698
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved